Incidental Mutation 'R4846:Axin2'
ID 372182
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Name axin 2
Synonyms Axil, Conductin
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 108811175-108841609 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108833125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000051331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711]
AlphaFold O88566
Predicted Effect probably benign
Transcript: ENSMUST00000052915
AA Change: T437A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: T437A

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106711
AA Change: T437A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142
AA Change: T437A

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144130
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108,814,816 (GRCm39) missense probably benign
IGL01094:Axin2 APN 11 108,814,501 (GRCm39) missense probably damaging 0.99
IGL01563:Axin2 APN 11 108,814,631 (GRCm39) missense probably damaging 0.97
IGL02088:Axin2 APN 11 108,814,442 (GRCm39) missense probably damaging 1.00
IGL02724:Axin2 APN 11 108,833,772 (GRCm39) missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108,814,829 (GRCm39) missense possibly damaging 0.85
R0029:Axin2 UTSW 11 108,814,873 (GRCm39) missense probably benign 0.01
R0052:Axin2 UTSW 11 108,840,096 (GRCm39) missense probably damaging 1.00
R0112:Axin2 UTSW 11 108,830,223 (GRCm39) missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108,814,936 (GRCm39) unclassified probably benign
R0372:Axin2 UTSW 11 108,814,159 (GRCm39) missense probably damaging 1.00
R1200:Axin2 UTSW 11 108,822,376 (GRCm39) missense probably damaging 0.98
R1924:Axin2 UTSW 11 108,833,794 (GRCm39) missense probably benign 0.02
R2025:Axin2 UTSW 11 108,833,904 (GRCm39) missense probably damaging 1.00
R2427:Axin2 UTSW 11 108,814,800 (GRCm39) missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108,833,402 (GRCm39) missense possibly damaging 0.89
R4781:Axin2 UTSW 11 108,834,682 (GRCm39) missense probably damaging 1.00
R4956:Axin2 UTSW 11 108,833,904 (GRCm39) missense probably damaging 1.00
R7365:Axin2 UTSW 11 108,830,202 (GRCm39) missense possibly damaging 0.93
R7519:Axin2 UTSW 11 108,833,072 (GRCm39) missense probably benign 0.00
R7662:Axin2 UTSW 11 108,833,282 (GRCm39) missense possibly damaging 0.96
R7947:Axin2 UTSW 11 108,814,529 (GRCm39) missense probably damaging 1.00
R8103:Axin2 UTSW 11 108,822,369 (GRCm39) missense probably damaging 0.99
R8766:Axin2 UTSW 11 108,814,657 (GRCm39) missense probably damaging 1.00
R8917:Axin2 UTSW 11 108,822,341 (GRCm39) missense probably damaging 1.00
R9043:Axin2 UTSW 11 108,833,794 (GRCm39) missense probably benign 0.02
R9169:Axin2 UTSW 11 108,822,378 (GRCm39) missense probably damaging 1.00
R9279:Axin2 UTSW 11 108,833,128 (GRCm39) missense possibly damaging 0.91
R9358:Axin2 UTSW 11 108,814,873 (GRCm39) missense probably benign 0.01
R9467:Axin2 UTSW 11 108,833,782 (GRCm39) missense possibly damaging 0.94
R9789:Axin2 UTSW 11 108,840,180 (GRCm39) missense probably damaging 1.00
X0054:Axin2 UTSW 11 108,814,400 (GRCm39) missense probably damaging 1.00
Z1177:Axin2 UTSW 11 108,814,300 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGCATGCAGAAACG -3'
(R):5'- TTGGTCAGGAAGCTCTTGC -3'

Sequencing Primer
(F):5'- TGCAGAAACGCGCATGC -3'
(R):5'- AAGCTCTTGCCTCCAAGGAG -3'
Posted On 2016-03-01