Incidental Mutation 'R4846:Axin2'
ID 372182
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Name axin 2
Synonyms Axil, Conductin
MMRRC Submission 042459-MU
Accession Numbers

Genbank: NM_015732; MGI: 1270862

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 108920349-108950783 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108942299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000051331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711]
AlphaFold O88566
Predicted Effect probably benign
Transcript: ENSMUST00000052915
AA Change: T437A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: T437A

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106711
AA Change: T437A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142
AA Change: T437A

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144130
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108923990 missense probably benign
IGL01094:Axin2 APN 11 108923675 missense probably damaging 0.99
IGL01563:Axin2 APN 11 108923805 missense probably damaging 0.97
IGL02088:Axin2 APN 11 108923616 missense probably damaging 1.00
IGL02724:Axin2 APN 11 108942946 missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108924003 missense possibly damaging 0.85
R0029:Axin2 UTSW 11 108924047 missense probably benign 0.01
R0052:Axin2 UTSW 11 108949270 missense probably damaging 1.00
R0112:Axin2 UTSW 11 108939397 missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108923333 missense probably damaging 1.00
R0372:Axin2 UTSW 11 108924110 unclassified probably benign
R1200:Axin2 UTSW 11 108931550 missense probably damaging 0.98
R1924:Axin2 UTSW 11 108942968 missense probably benign 0.02
R2025:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R2427:Axin2 UTSW 11 108923974 missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108942576 missense possibly damaging 0.89
R4781:Axin2 UTSW 11 108943856 missense probably damaging 1.00
R4956:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R7365:Axin2 UTSW 11 108939376 missense possibly damaging 0.93
R7519:Axin2 UTSW 11 108942246 missense probably benign 0.00
R7662:Axin2 UTSW 11 108942456 missense possibly damaging 0.96
R7947:Axin2 UTSW 11 108923703 missense probably damaging 1.00
R8103:Axin2 UTSW 11 108931543 missense probably damaging 0.99
R8766:Axin2 UTSW 11 108923831 missense probably damaging 1.00
R8917:Axin2 UTSW 11 108931515 missense probably damaging 1.00
R9043:Axin2 UTSW 11 108942968 missense probably benign 0.02
R9169:Axin2 UTSW 11 108931552 missense probably damaging 1.00
R9279:Axin2 UTSW 11 108942302 missense possibly damaging 0.91
R9358:Axin2 UTSW 11 108924047 missense probably benign 0.01
R9467:Axin2 UTSW 11 108942956 missense possibly damaging 0.94
R9789:Axin2 UTSW 11 108949354 missense probably damaging 1.00
X0054:Axin2 UTSW 11 108923574 missense probably damaging 1.00
Z1177:Axin2 UTSW 11 108923474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTGCATGCAGAAACG -3'
(R):5'- TTGGTCAGGAAGCTCTTGC -3'

Sequencing Primer
(F):5'- TGCAGAAACGCGCATGC -3'
(R):5'- AAGCTCTTGCCTCCAAGGAG -3'
Posted On 2016-03-01