Incidental Mutation 'R4846:Gprc5c'
ID372183
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene NameG protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114851152-114872617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114864267 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4902:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5109:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5267:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5557:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5729:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- TCAGGATGGTCTCATAGCCC -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- GGGTACATGTCCCCCTGGTAG -3'
Posted On2016-03-01