Incidental Mutation 'R4846:Socs3'
ID372184
Institutional Source Beutler Lab
Gene Symbol Socs3
Ensembl Gene ENSMUSG00000053113
Gene Namesuppressor of cytokine signaling 3
SynonymsCish3, SOCS-3, E2a-Pbx1 target gene in fibroblasts 10, STAT-induced STAT inhibitor 3, CIS3, SSI-3, cytokine-inducible SH2 protein 3, EF-10
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117966079-117970047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117967828 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000059129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054002]
PDB Structure
solution structure of mouse socs3 in complex with a phosphopeptide from the gp130 receptor [SOLUTION NMR]
Crystal structure of SOCS3 in complex with gp130(pTyr757) phosphopeptide. [X-RAY DIFFRACTION]
SOCS box elonginBC ternary complex [SOLUTION NMR]
Crystal structure of inhibitory protein SOCS3 in complex with JAK2 kinase domain and fragment of GP130 intracellular domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000054002
AA Change: S135P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059129
Gene: ENSMUSG00000053113
AA Change: S135P

DomainStartEndE-ValueType
SH2 44 133 2.21e-20 SMART
SOCS 180 222 2.66e-14 SMART
SOCS_box 186 221 6.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132295
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene is induced by various cytokines, including IL6, IL10, and interferon (IFN)-gamma. The protein encoded by this gene can bind to JAK2 kinase, and inhibit the activity of JAK2 kinase. Studies of the mouse counterpart of this gene suggested the roles of this gene in the negative regulation of fetal liver hematopoiesis, and placental development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations cause impairment if gene expression show immunological and hematopoetic abnormalities. Complete gene disruption causes lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Socs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1483:Socs3 UTSW 11 117967568 nonsense probably null
R4998:Socs3 UTSW 11 117967716 missense probably damaging 1.00
R5789:Socs3 UTSW 11 117967782 missense probably benign 0.28
R7174:Socs3 UTSW 11 117967727 nonsense probably null
R7311:Socs3 UTSW 11 117967788 missense probably benign 0.01
X0063:Socs3 UTSW 11 117967619 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTCACTTTCTCATAGGAGTCC -3'
(R):5'- AGCGCCACTTCTTCACGTTG -3'

Sequencing Primer
(F):5'- TCTTCCGACAAAGATGCTGG -3'
(R):5'- TTGAGCGTCAAGACCCAGTC -3'
Posted On2016-03-01