Incidental Mutation 'R4846:Cd200'
ID 372192
Institutional Source Beutler Lab
Gene Symbol Cd200
Ensembl Gene ENSMUSG00000022661
Gene Name CD200 antigen
Synonyms OX2, Mox2, MRC OX-2
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45382135-45409053 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45392301 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 261 (R261H)
Ref Sequence ENSEMBL: ENSMUSP00000130518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023341] [ENSMUST00000163230] [ENSMUST00000166512] [ENSMUST00000167355]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023341
AA Change: R261H

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023341
Gene: ENSMUSG00000022661
AA Change: R261H

DomainStartEndE-ValueType
IGv 46 123 5.24e-7 SMART
Pfam:C2-set_2 142 220 2.6e-9 PFAM
Pfam:Ig_2 148 206 2.9e-3 PFAM
Pfam:ig 153 216 6.4e-8 PFAM
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163230
AA Change: R261H

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130518
Gene: ENSMUSG00000022661
AA Change: R261H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGv 46 123 5.24e-7 SMART
Pfam:C2-set_2 142 221 5.5e-8 PFAM
Pfam:ig 143 229 8e-11 PFAM
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165910
Predicted Effect probably benign
Transcript: ENSMUST00000166512
SMART Domains Protein: ENSMUSP00000129541
Gene: ENSMUSG00000022661

DomainStartEndE-ValueType
IGv 46 123 5.24e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166630
Predicted Effect probably benign
Transcript: ENSMUST00000167355
SMART Domains Protein: ENSMUSP00000132506
Gene: ENSMUSG00000022661

DomainStartEndE-ValueType
IGv 25 102 5.24e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171855
Meta Mutation Damage Score 0.1007 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane glycoprotein containing two extracellular immunoglobulin domains, a transmembrane and a cytoplasmic domain. This gene is expressed by various cell types, including B cells, a subset of T cells, thymocytes, endothelial cells, and neurons. The encoded protein plays an important role in immunosuppression and regulation of anti-tumor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased levels of all macrophage lineages. Macrophage are activated and mice display an increased susceptibility to autoimmune disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Cd200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cd200 APN 16 45397046 missense probably damaging 1.00
IGL00583:Cd200 APN 16 45397109 missense probably damaging 0.97
IGL01014:Cd200 APN 16 45394700 missense probably benign 0.11
IGL01567:Cd200 APN 16 45394691 missense probably damaging 1.00
IGL01616:Cd200 APN 16 45397056 missense possibly damaging 0.90
R0442:Cd200 UTSW 16 45397155 missense probably damaging 1.00
R0667:Cd200 UTSW 16 45394857 missense probably benign 0.09
R0675:Cd200 UTSW 16 45397110 missense probably benign 0.01
R1163:Cd200 UTSW 16 45392352 missense probably damaging 1.00
R1595:Cd200 UTSW 16 45394851 missense probably benign 0.16
R4882:Cd200 UTSW 16 45397017 missense probably benign 0.15
R5790:Cd200 UTSW 16 45397258 missense possibly damaging 0.47
R6307:Cd200 UTSW 16 45397182 missense probably benign 0.00
R6523:Cd200 UTSW 16 45400270 missense probably benign 0.03
R7175:Cd200 UTSW 16 45400215 splice site probably null
R8825:Cd200 UTSW 16 45394794 missense probably benign 0.34
R8826:Cd200 UTSW 16 45394794 missense probably benign 0.34
R8828:Cd200 UTSW 16 45394794 missense probably benign 0.34
X0063:Cd200 UTSW 16 45394831 makesense probably null
Z1177:Cd200 UTSW 16 45394688 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCAAGAAAGCAAGCTTGTTG -3'
(R):5'- ATGACCGTAACTGCGTGTGC -3'

Sequencing Primer
(F):5'- GCTTGTTGCTTTTCTTAAACAGC -3'
(R):5'- GAGCTCTCAGTTCTTATAAAAACCC -3'
Posted On 2016-03-01