Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Galnt14'

372193

Institutional Source

Beutler Lab

Gene Symbol

Galnt14

Ensembl Gene

ENSMUSG00000024064

Gene Name

polypeptide N-acetylgalactosaminyltransferase 14

Synonyms

0610033M06Rik

MMRRC Submission

042459-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73493228-73710453 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73536893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 140 (M140K)

Ref Sequence

ENSEMBL: ENSMUSP00000024858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024858] [ENSMUST00000112591]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024858
AA Change: M140K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000024858
Gene: ENSMUSG00000024064
AA Change: M140K

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	111	359	1.4e-10	PFAM
Pfam:Glycos_transf_2	114	294	7.5e-30	PFAM
Pfam:Glyco_tranf_2_2	114	333	1.5e-8	PFAM
Pfam:Glyco_transf_7C	271	340	7e-8	PFAM
RICIN	420	548	7.23e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112591
AA Change: M140K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108210
Gene: ENSMUSG00000024064
AA Change: M140K

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	111	359	1.1e-10	PFAM
Pfam:Glycos_transf_2	114	291	2.4e-27	PFAM
Pfam:Glyco_tranf_2_2	114	333	1.7e-8	PFAM
Pfam:Glyco_transf_7C	270	340	9e-8	PFAM
low complexity region	415	429	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Galnt14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Galnt14	APN	17	73494232	missense	probably damaging	1.00
IGL01295:Galnt14	APN	17	73504919	missense	probably benign	0.01
IGL01578:Galnt14	APN	17	73535366	splice site	probably benign
IGL01833:Galnt14	APN	17	73504904	missense	probably benign
IGL02572:Galnt14	APN	17	73535267	missense	probably damaging	1.00
IGL02890:Galnt14	APN	17	73509524	critical splice donor site	probably null
IGL03145:Galnt14	APN	17	73504908	missense	possibly damaging	0.63
IGL03175:Galnt14	APN	17	73522654	missense	probably damaging	1.00
R0051:Galnt14	UTSW	17	73507859	missense	probably benign	0.00
R0112:Galnt14	UTSW	17	73574984	splice site	probably benign
R0167:Galnt14	UTSW	17	73522720	missense	probably damaging	1.00
R0525:Galnt14	UTSW	17	73545081	missense	probably damaging	1.00
R0675:Galnt14	UTSW	17	73545035	missense	probably damaging	1.00
R1192:Galnt14	UTSW	17	73545138	splice site	probably benign
R1335:Galnt14	UTSW	17	73526290	missense	probably damaging	1.00
R1549:Galnt14	UTSW	17	73525313	missense	possibly damaging	0.79
R1824:Galnt14	UTSW	17	73709939	missense	probably benign	0.01
R2061:Galnt14	UTSW	17	73512153	missense	probably damaging	1.00
R2259:Galnt14	UTSW	17	73494266	missense	probably benign	0.00
R3844:Galnt14	UTSW	17	73709929	critical splice donor site	probably null
R4257:Galnt14	UTSW	17	73504904	missense	probably benign
R4364:Galnt14	UTSW	17	73512159	missense	probably damaging	0.99
R4664:Galnt14	UTSW	17	73507813	intron	probably benign
R4744:Galnt14	UTSW	17	73507833	missense	probably damaging	1.00
R4810:Galnt14	UTSW	17	73512121	missense	probably damaging	0.99
R4840:Galnt14	UTSW	17	73504898	missense	probably benign	0.01
R5328:Galnt14	UTSW	17	73505459	missense	possibly damaging	0.46
R5507:Galnt14	UTSW	17	73495666	missense	probably damaging	0.98
R5816:Galnt14	UTSW	17	73574882	missense	probably damaging	1.00
R5872:Galnt14	UTSW	17	73574831	missense	probably damaging	1.00
R5933:Galnt14	UTSW	17	73526305	missense	probably benign	0.01
R6490:Galnt14	UTSW	17	73525370	missense	probably damaging	0.98
R7117:Galnt14	UTSW	17	73494195	missense	probably benign	0.00
R7128:Galnt14	UTSW	17	73545101	missense	probably benign
R7451:Galnt14	UTSW	17	73574809	missense	probably benign	0.00
R7604:Galnt14	UTSW	17	73504921	missense	possibly damaging	0.94
R7786:Galnt14	UTSW	17	73709981	missense	probably benign	0.00
R8693:Galnt14	UTSW	17	73526262	missense	probably damaging	1.00
R9573:Galnt14	UTSW	17	73495667	missense	probably damaging	1.00
X0067:Galnt14	UTSW	17	73509526	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCAGAGAGCAGCAAAAGTTTTCTC -3'
(R):5'- CAGTGCCCTGGATGAGTAAC -3'

Sequencing Primer
(F):5'- TGAAGCTTAGTCATAAACACGC -3'
(R):5'- CAACAGGATGAGTGGGCATCTTC -3'

Posted On

2016-03-01