Incidental Mutation 'R4846:Galnt14'
ID 372193
Institutional Source Beutler Lab
Gene Symbol Galnt14
Ensembl Gene ENSMUSG00000024064
Gene Name polypeptide N-acetylgalactosaminyltransferase 14
Synonyms 0610033M06Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 73493228-73710453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73536893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 140 (M140K)
Ref Sequence ENSEMBL: ENSMUSP00000024858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024858] [ENSMUST00000112591]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024858
AA Change: M140K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024858
Gene: ENSMUSG00000024064
AA Change: M140K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.4e-10 PFAM
Pfam:Glycos_transf_2 114 294 7.5e-30 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.5e-8 PFAM
Pfam:Glyco_transf_7C 271 340 7e-8 PFAM
RICIN 420 548 7.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112591
AA Change: M140K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108210
Gene: ENSMUSG00000024064
AA Change: M140K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.1e-10 PFAM
Pfam:Glycos_transf_2 114 291 2.4e-27 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.7e-8 PFAM
Pfam:Glyco_transf_7C 270 340 9e-8 PFAM
low complexity region 415 429 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Galnt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Galnt14 APN 17 73494232 missense probably damaging 1.00
IGL01295:Galnt14 APN 17 73504919 missense probably benign 0.01
IGL01578:Galnt14 APN 17 73535366 splice site probably benign
IGL01833:Galnt14 APN 17 73504904 missense probably benign
IGL02572:Galnt14 APN 17 73535267 missense probably damaging 1.00
IGL02890:Galnt14 APN 17 73509524 critical splice donor site probably null
IGL03145:Galnt14 APN 17 73504908 missense possibly damaging 0.63
IGL03175:Galnt14 APN 17 73522654 missense probably damaging 1.00
R0051:Galnt14 UTSW 17 73507859 missense probably benign 0.00
R0112:Galnt14 UTSW 17 73574984 splice site probably benign
R0167:Galnt14 UTSW 17 73522720 missense probably damaging 1.00
R0525:Galnt14 UTSW 17 73545081 missense probably damaging 1.00
R0675:Galnt14 UTSW 17 73545035 missense probably damaging 1.00
R1192:Galnt14 UTSW 17 73545138 splice site probably benign
R1335:Galnt14 UTSW 17 73526290 missense probably damaging 1.00
R1549:Galnt14 UTSW 17 73525313 missense possibly damaging 0.79
R1824:Galnt14 UTSW 17 73709939 missense probably benign 0.01
R2061:Galnt14 UTSW 17 73512153 missense probably damaging 1.00
R2259:Galnt14 UTSW 17 73494266 missense probably benign 0.00
R3844:Galnt14 UTSW 17 73709929 critical splice donor site probably null
R4257:Galnt14 UTSW 17 73504904 missense probably benign
R4364:Galnt14 UTSW 17 73512159 missense probably damaging 0.99
R4664:Galnt14 UTSW 17 73507813 intron probably benign
R4744:Galnt14 UTSW 17 73507833 missense probably damaging 1.00
R4810:Galnt14 UTSW 17 73512121 missense probably damaging 0.99
R4840:Galnt14 UTSW 17 73504898 missense probably benign 0.01
R5328:Galnt14 UTSW 17 73505459 missense possibly damaging 0.46
R5507:Galnt14 UTSW 17 73495666 missense probably damaging 0.98
R5816:Galnt14 UTSW 17 73574882 missense probably damaging 1.00
R5872:Galnt14 UTSW 17 73574831 missense probably damaging 1.00
R5933:Galnt14 UTSW 17 73526305 missense probably benign 0.01
R6490:Galnt14 UTSW 17 73525370 missense probably damaging 0.98
R7117:Galnt14 UTSW 17 73494195 missense probably benign 0.00
R7128:Galnt14 UTSW 17 73545101 missense probably benign
R7451:Galnt14 UTSW 17 73574809 missense probably benign 0.00
R7604:Galnt14 UTSW 17 73504921 missense possibly damaging 0.94
R7786:Galnt14 UTSW 17 73709981 missense probably benign 0.00
R8693:Galnt14 UTSW 17 73526262 missense probably damaging 1.00
R9573:Galnt14 UTSW 17 73495667 missense not run
X0067:Galnt14 UTSW 17 73509526 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGAGAGCAGCAAAAGTTTTCTC -3'
(R):5'- CAGTGCCCTGGATGAGTAAC -3'

Sequencing Primer
(F):5'- TGAAGCTTAGTCATAAACACGC -3'
(R):5'- CAACAGGATGAGTGGGCATCTTC -3'
Posted On 2016-03-01