Incidental Mutation 'R4858:Speg'
ID372197
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4858 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75421735 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1942 (R1942L)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: R1942L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: R1942L

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: R1689L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143679
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTCAAATCAGCTACAAGTG -3'
(R):5'- TCTCAGCAGAGCTACCCCTG -3'

Sequencing Primer
(F):5'- TCAGCTACAAGTGCCACCTGG -3'
(R):5'- AGAGCTACCCCTGCGGAG -3'
Posted On2016-03-01