Incidental Mutation 'R4858:Speg'
ID 372197
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 042469-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4858 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 75398379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1942 (R1942L)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: R1942L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: R1942L

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: R1689L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143679
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,225,321 (GRCm39) Y1415C probably damaging Het
Adgrf1 T C 17: 43,614,563 (GRCm39) S216P probably damaging Het
Ankrd12 T C 17: 66,338,428 (GRCm39) D197G probably damaging Het
Aoc3 C A 11: 101,222,488 (GRCm39) H198Q probably damaging Het
Aox1 C A 1: 58,143,640 (GRCm39) H1253N probably benign Het
Arg1 T A 10: 24,798,536 (GRCm39) E38V possibly damaging Het
Baz2b T A 2: 59,738,087 (GRCm39) M1741L probably benign Het
Bend4 T C 5: 67,574,915 (GRCm39) E322G probably damaging Het
Brpf1 T C 6: 113,294,639 (GRCm39) V661A possibly damaging Het
C2cd3 A T 7: 100,104,160 (GRCm39) T2058S probably damaging Het
Camk4 T C 18: 33,309,266 (GRCm39) V223A probably damaging Het
Casp1 C T 9: 5,306,742 (GRCm39) R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 (GRCm39) I1066S probably damaging Het
Ccne1 A G 7: 37,798,744 (GRCm39) F292L probably damaging Het
Ccz1 A T 5: 143,949,628 (GRCm39) M100K probably damaging Het
Cep128 T C 12: 91,226,936 (GRCm39) T678A probably benign Het
Cep290 G A 10: 100,330,773 (GRCm39) R151Q probably benign Het
Crip3 A G 17: 46,741,673 (GRCm39) probably benign Het
Ddx60 A G 8: 62,474,348 (GRCm39) M1479V possibly damaging Het
Defb40 T A 8: 19,025,093 (GRCm39) I38F probably benign Het
Dnajb2 C T 1: 75,220,198 (GRCm39) T221I possibly damaging Het
Dpysl3 T C 18: 43,467,079 (GRCm39) I279V probably damaging Het
Echs1 G A 7: 139,692,499 (GRCm39) probably benign Het
Efl1 T A 7: 82,320,835 (GRCm39) N89K probably damaging Het
Extl3 T C 14: 65,313,443 (GRCm39) T580A probably benign Het
Fam171a2 C T 11: 102,330,982 (GRCm39) G193E probably damaging Het
Fam234a A T 17: 26,435,591 (GRCm39) D264E probably benign Het
Fbxw20 A T 9: 109,063,763 (GRCm39) V3D possibly damaging Het
Fig4 G A 10: 41,109,586 (GRCm39) P637L probably benign Het
Fnbp1l G A 3: 122,339,964 (GRCm39) T496I probably benign Het
Fry T C 5: 150,325,108 (GRCm39) V1175A possibly damaging Het
Gm5617 C T 9: 48,406,968 (GRCm39) A34V possibly damaging Het
Gnai1 A T 5: 18,496,596 (GRCm39) V109E probably benign Het
H2-K2 A T 17: 34,216,298 (GRCm39) Y283N probably benign Het
Hectd2 A T 19: 36,582,682 (GRCm39) I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 (GRCm39) probably null Het
Igkv3-1 T C 6: 70,681,028 (GRCm39) S76P probably damaging Het
Krt15 A T 11: 100,022,897 (GRCm39) S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Lima1 G A 15: 99,717,457 (GRCm39) T23I probably benign Het
Map4k1 C A 7: 28,688,195 (GRCm39) H248Q probably damaging Het
Mcf2l C A 8: 13,063,972 (GRCm39) T1004K probably damaging Het
Meak7 T G 8: 120,499,262 (GRCm39) T77P probably benign Het
Micall1 T A 15: 79,007,146 (GRCm39) probably benign Het
Ms4a14 A G 19: 11,278,976 (GRCm39) I1194T probably benign Het
Mtor T C 4: 148,539,273 (GRCm39) *257Q probably null Het
Mucl3 G A 17: 35,948,468 (GRCm39) T377I possibly damaging Het
Ncan T A 8: 70,556,705 (GRCm39) T961S probably benign Het
Odad4 A G 11: 100,441,147 (GRCm39) N126S probably damaging Het
Or10z1 A T 1: 174,078,262 (GRCm39) I77N probably damaging Het
Or1e29 T A 11: 73,667,372 (GRCm39) L260F probably benign Het
Or1f19 T C 16: 3,410,706 (GRCm39) S149P probably damaging Het
Or2t49 T A 11: 58,392,735 (GRCm39) I216F probably damaging Het
Or8h10 T G 2: 86,808,693 (GRCm39) Y149S probably damaging Het
Or9e1 T A 11: 58,732,033 (GRCm39) L31H possibly damaging Het
Pcdhgb2 A G 18: 37,825,153 (GRCm39) R715G probably benign Het
Pik3c3 T C 18: 30,477,131 (GRCm39) probably null Het
Pkhd1l1 A T 15: 44,354,497 (GRCm39) D296V probably damaging Het
Plekhh2 A G 17: 84,908,125 (GRCm39) I1189V probably damaging Het
Psg18 A T 7: 18,087,409 (GRCm39) L83Q possibly damaging Het
Rps6kc1 A G 1: 190,532,515 (GRCm39) W496R probably damaging Het
Setd5 C T 6: 113,126,527 (GRCm39) T1188I probably damaging Het
Slc4a3 T C 1: 75,531,729 (GRCm39) F899L probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Sulf2 C A 2: 165,923,524 (GRCm39) R565L probably benign Het
Tcerg1 T C 18: 42,657,046 (GRCm39) M176T unknown Het
Tfcp2l1 T C 1: 118,597,239 (GRCm39) I440T possibly damaging Het
Tgm7 A T 2: 120,929,445 (GRCm39) probably null Het
Tjp2 C A 19: 24,099,484 (GRCm39) G433V probably damaging Het
Tmc7 C T 7: 118,142,565 (GRCm39) G608R probably damaging Het
Tmed4 A G 11: 6,224,456 (GRCm39) F68S possibly damaging Het
Tmem30b G A 12: 73,592,686 (GRCm39) P143L probably damaging Het
Tnfrsf23 C T 7: 143,235,217 (GRCm39) C49Y probably damaging Het
Tnni3k A T 3: 154,492,445 (GRCm39) probably null Het
Trav12-2 G T 14: 53,854,150 (GRCm39) M41I probably benign Het
Trim6 T A 7: 103,881,692 (GRCm39) Y314* probably null Het
Utp25 A G 1: 192,796,072 (GRCm39) Y686H probably damaging Het
Vmn2r118 A G 17: 55,899,894 (GRCm39) V670A probably damaging Het
Zfp438 A T 18: 5,213,154 (GRCm39) D601E probably benign Het
Zfp606 T A 7: 12,226,983 (GRCm39) I310N possibly damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCAAATCAGCTACAAGTG -3'
(R):5'- TCTCAGCAGAGCTACCCCTG -3'

Sequencing Primer
(F):5'- TCAGCTACAAGTGCCACCTGG -3'
(R):5'- AGAGCTACCCCTGCGGAG -3'
Posted On 2016-03-01