Incidental Mutation 'R4858:Ccne1'
ID372223
Institutional Source Beutler Lab
Gene Symbol Ccne1
Ensembl Gene ENSMUSG00000002068
Gene Namecyclin E1
SynonymsCycE1, cyclin E
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location38097984-38107534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38099319 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 292 (F292L)
Ref Sequence ENSEMBL: ENSMUSP00000103658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108023] [ENSMUST00000124979] [ENSMUST00000130329]
Predicted Effect probably damaging
Transcript: ENSMUST00000108023
AA Change: F292L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103658
Gene: ENSMUSG00000002068
AA Change: F292L

DomainStartEndE-ValueType
CYCLIN 148 233 5.88e-26 SMART
Cyclin_C 242 364 2.36e-13 SMART
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128785
Predicted Effect probably benign
Transcript: ENSMUST00000130329
SMART Domains Protein: ENSMUSP00000117662
Gene: ENSMUSG00000002068

DomainStartEndE-ValueType
Pfam:Cyclin_N 113 167 5.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137097
Meta Mutation Damage Score 0.6212 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Ccne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Ccne1 APN 7 38106301 missense probably benign 0.22
IGL02377:Ccne1 APN 7 38098990 critical splice donor site probably null
IGL02800:Ccne1 APN 7 38102799 missense probably damaging 1.00
R1355:Ccne1 UTSW 7 38106322 missense possibly damaging 0.80
R1938:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R4810:Ccne1 UTSW 7 38099593 missense probably damaging 1.00
R4982:Ccne1 UTSW 7 38100571 missense probably damaging 1.00
R6480:Ccne1 UTSW 7 38106854 start gained probably benign
R6981:Ccne1 UTSW 7 38098573 unclassified probably benign
R7165:Ccne1 UTSW 7 38099301 missense probably damaging 1.00
R7398:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R7458:Ccne1 UTSW 7 38100671 missense probably damaging 1.00
R7835:Ccne1 UTSW 7 38102845 missense probably benign 0.03
R7918:Ccne1 UTSW 7 38102845 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCGCACCACTGATAACCTGC -3'
(R):5'- TATGTCAACGACACGGGTG -3'

Sequencing Primer
(F):5'- TGATAACCTGCCAGTAAAGAAGTC -3'
(R):5'- AGTACCCACAGCAGGTCTTCG -3'
Posted On2016-03-01