Incidental Mutation 'R4858:Efl1'
ID 372225
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 042469-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R4858 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82320835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 89 (N89K)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000141726] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: N89K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: N89K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: N89K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: N89K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153265
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: N89K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: N89K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Meta Mutation Damage Score 0.7736 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,225,321 (GRCm39) Y1415C probably damaging Het
Adgrf1 T C 17: 43,614,563 (GRCm39) S216P probably damaging Het
Ankrd12 T C 17: 66,338,428 (GRCm39) D197G probably damaging Het
Aoc3 C A 11: 101,222,488 (GRCm39) H198Q probably damaging Het
Aox1 C A 1: 58,143,640 (GRCm39) H1253N probably benign Het
Arg1 T A 10: 24,798,536 (GRCm39) E38V possibly damaging Het
Baz2b T A 2: 59,738,087 (GRCm39) M1741L probably benign Het
Bend4 T C 5: 67,574,915 (GRCm39) E322G probably damaging Het
Brpf1 T C 6: 113,294,639 (GRCm39) V661A possibly damaging Het
C2cd3 A T 7: 100,104,160 (GRCm39) T2058S probably damaging Het
Camk4 T C 18: 33,309,266 (GRCm39) V223A probably damaging Het
Casp1 C T 9: 5,306,742 (GRCm39) R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 (GRCm39) I1066S probably damaging Het
Ccne1 A G 7: 37,798,744 (GRCm39) F292L probably damaging Het
Ccz1 A T 5: 143,949,628 (GRCm39) M100K probably damaging Het
Cep128 T C 12: 91,226,936 (GRCm39) T678A probably benign Het
Cep290 G A 10: 100,330,773 (GRCm39) R151Q probably benign Het
Crip3 A G 17: 46,741,673 (GRCm39) probably benign Het
Ddx60 A G 8: 62,474,348 (GRCm39) M1479V possibly damaging Het
Defb40 T A 8: 19,025,093 (GRCm39) I38F probably benign Het
Dnajb2 C T 1: 75,220,198 (GRCm39) T221I possibly damaging Het
Dpysl3 T C 18: 43,467,079 (GRCm39) I279V probably damaging Het
Echs1 G A 7: 139,692,499 (GRCm39) probably benign Het
Extl3 T C 14: 65,313,443 (GRCm39) T580A probably benign Het
Fam171a2 C T 11: 102,330,982 (GRCm39) G193E probably damaging Het
Fam234a A T 17: 26,435,591 (GRCm39) D264E probably benign Het
Fbxw20 A T 9: 109,063,763 (GRCm39) V3D possibly damaging Het
Fig4 G A 10: 41,109,586 (GRCm39) P637L probably benign Het
Fnbp1l G A 3: 122,339,964 (GRCm39) T496I probably benign Het
Fry T C 5: 150,325,108 (GRCm39) V1175A possibly damaging Het
Gm5617 C T 9: 48,406,968 (GRCm39) A34V possibly damaging Het
Gnai1 A T 5: 18,496,596 (GRCm39) V109E probably benign Het
H2-K2 A T 17: 34,216,298 (GRCm39) Y283N probably benign Het
Hectd2 A T 19: 36,582,682 (GRCm39) I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 (GRCm39) probably null Het
Igkv3-1 T C 6: 70,681,028 (GRCm39) S76P probably damaging Het
Krt15 A T 11: 100,022,897 (GRCm39) S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Lima1 G A 15: 99,717,457 (GRCm39) T23I probably benign Het
Map4k1 C A 7: 28,688,195 (GRCm39) H248Q probably damaging Het
Mcf2l C A 8: 13,063,972 (GRCm39) T1004K probably damaging Het
Meak7 T G 8: 120,499,262 (GRCm39) T77P probably benign Het
Micall1 T A 15: 79,007,146 (GRCm39) probably benign Het
Ms4a14 A G 19: 11,278,976 (GRCm39) I1194T probably benign Het
Mtor T C 4: 148,539,273 (GRCm39) *257Q probably null Het
Mucl3 G A 17: 35,948,468 (GRCm39) T377I possibly damaging Het
Ncan T A 8: 70,556,705 (GRCm39) T961S probably benign Het
Odad4 A G 11: 100,441,147 (GRCm39) N126S probably damaging Het
Or10z1 A T 1: 174,078,262 (GRCm39) I77N probably damaging Het
Or1e29 T A 11: 73,667,372 (GRCm39) L260F probably benign Het
Or1f19 T C 16: 3,410,706 (GRCm39) S149P probably damaging Het
Or2t49 T A 11: 58,392,735 (GRCm39) I216F probably damaging Het
Or8h10 T G 2: 86,808,693 (GRCm39) Y149S probably damaging Het
Or9e1 T A 11: 58,732,033 (GRCm39) L31H possibly damaging Het
Pcdhgb2 A G 18: 37,825,153 (GRCm39) R715G probably benign Het
Pik3c3 T C 18: 30,477,131 (GRCm39) probably null Het
Pkhd1l1 A T 15: 44,354,497 (GRCm39) D296V probably damaging Het
Plekhh2 A G 17: 84,908,125 (GRCm39) I1189V probably damaging Het
Psg18 A T 7: 18,087,409 (GRCm39) L83Q possibly damaging Het
Rps6kc1 A G 1: 190,532,515 (GRCm39) W496R probably damaging Het
Setd5 C T 6: 113,126,527 (GRCm39) T1188I probably damaging Het
Slc4a3 T C 1: 75,531,729 (GRCm39) F899L probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Speg G T 1: 75,398,379 (GRCm39) R1942L probably damaging Het
Sulf2 C A 2: 165,923,524 (GRCm39) R565L probably benign Het
Tcerg1 T C 18: 42,657,046 (GRCm39) M176T unknown Het
Tfcp2l1 T C 1: 118,597,239 (GRCm39) I440T possibly damaging Het
Tgm7 A T 2: 120,929,445 (GRCm39) probably null Het
Tjp2 C A 19: 24,099,484 (GRCm39) G433V probably damaging Het
Tmc7 C T 7: 118,142,565 (GRCm39) G608R probably damaging Het
Tmed4 A G 11: 6,224,456 (GRCm39) F68S possibly damaging Het
Tmem30b G A 12: 73,592,686 (GRCm39) P143L probably damaging Het
Tnfrsf23 C T 7: 143,235,217 (GRCm39) C49Y probably damaging Het
Tnni3k A T 3: 154,492,445 (GRCm39) probably null Het
Trav12-2 G T 14: 53,854,150 (GRCm39) M41I probably benign Het
Trim6 T A 7: 103,881,692 (GRCm39) Y314* probably null Het
Utp25 A G 1: 192,796,072 (GRCm39) Y686H probably damaging Het
Vmn2r118 A G 17: 55,899,894 (GRCm39) V670A probably damaging Het
Zfp438 A T 18: 5,213,154 (GRCm39) D601E probably benign Het
Zfp606 T A 7: 12,226,983 (GRCm39) I310N possibly damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTAAAAGTCTTTTCTGCGGTAC -3'
(R):5'- ACAGAGCAATCAACAGTGGC -3'

Sequencing Primer
(F):5'- TGCGGTACCAGGCATACTCTAAG -3'
(R):5'- ATCAACAGTGGCTGCACTTG -3'
Posted On 2016-03-01