Incidental Mutation 'R4858:Fbxw20'
ID372240
Institutional Source Beutler Lab
Gene Symbol Fbxw20
Ensembl Gene ENSMUSG00000061701
Gene NameF-box and WD-40 domain protein 20
Synonyms
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109217432-109234754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109234695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 3 (V3D)
Ref Sequence ENSEMBL: ENSMUSP00000078503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079548] [ENSMUST00000197329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079548
AA Change: V3D

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078503
Gene: ENSMUSG00000061701
AA Change: V3D

DomainStartEndE-ValueType
FBOX 5 45 2.37e-6 SMART
SCOP:d1tbga_ 116 249 5e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197329
AA Change: V3D

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143126
Gene: ENSMUSG00000061701
AA Change: V3D

DomainStartEndE-ValueType
FBOX 5 45 1.5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198261
Meta Mutation Damage Score 0.2006 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Fbxw20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Fbxw20 APN 9 109234702 start codon destroyed probably damaging 0.97
IGL01764:Fbxw20 APN 9 109223359 missense possibly damaging 0.71
IGL02149:Fbxw20 APN 9 109233818 critical splice donor site probably null
IGL02307:Fbxw20 APN 9 109233533 missense possibly damaging 0.70
IGL02335:Fbxw20 APN 9 109223309 missense possibly damaging 0.91
IGL02338:Fbxw20 APN 9 109225978 missense probably benign 0.00
PIT4377001:Fbxw20 UTSW 9 109221727 missense probably benign 0.00
PIT4434001:Fbxw20 UTSW 9 109223432 missense probably damaging 1.00
R0652:Fbxw20 UTSW 9 109232332 missense probably damaging 1.00
R1018:Fbxw20 UTSW 9 109221336 missense probably benign 0.03
R1114:Fbxw20 UTSW 9 109223482 missense probably damaging 1.00
R1596:Fbxw20 UTSW 9 109221300 missense probably damaging 1.00
R1692:Fbxw20 UTSW 9 109221709 missense possibly damaging 0.73
R1967:Fbxw20 UTSW 9 109217510 missense probably benign 0.00
R2055:Fbxw20 UTSW 9 109221374 missense probably damaging 0.99
R2224:Fbxw20 UTSW 9 109233582 missense possibly damaging 0.50
R4394:Fbxw20 UTSW 9 109232330 missense probably benign 0.00
R4617:Fbxw20 UTSW 9 109217563 missense probably damaging 1.00
R5794:Fbxw20 UTSW 9 109223290 missense probably damaging 0.97
R5794:Fbxw20 UTSW 9 109233600 missense possibly damaging 0.95
R6090:Fbxw20 UTSW 9 109223363 missense probably benign 0.03
R7161:Fbxw20 UTSW 9 109225980 missense probably damaging 1.00
R7328:Fbxw20 UTSW 9 109232315 missense probably damaging 1.00
R8004:Fbxw20 UTSW 9 109221381 missense probably damaging 1.00
R8258:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
R8259:Fbxw20 UTSW 9 109234695 missense probably benign 0.18
Z1177:Fbxw20 UTSW 9 109225887 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGAGACTCCAAGACTGAGTGG -3'
(R):5'- AAGGGGTTGTTGAGCTCATC -3'

Sequencing Primer
(F):5'- CTCCAAGACTGAGTGGGAAAGGC -3'
(R):5'- TCAACTGAGTGCATCTGGC -3'
Posted On2016-03-01