Incidental Mutation 'R4858:Fig4'
ID372244
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene NameFIG4 phosphoinositide 5-phosphatase
SynonymsA530089I17Rik
MMRRC Submission 042469-MU
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41188172-41303260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41233590 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 637 (P637L)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
Predicted Effect probably benign
Transcript: ENSMUST00000043814
AA Change: P637L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: P637L

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7452:Fig4 UTSW 10 41240637 missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCTCCTCCTAGAAGATGC -3'
(R):5'- CAACAGCTCTCCAAATGTGC -3'

Sequencing Primer
(F):5'- GATGCTAAGAGATACACGGTCCC -3'
(R):5'- TGCCATCACAGGAGGAGACC -3'
Posted On2016-03-01