Incidental Mutation 'R4858:Olfr389'
ID372249
Institutional Source Beutler Lab
Gene Symbol Olfr389
Ensembl Gene ENSMUSG00000070383
Gene Nameolfactory receptor 389
SynonymsMOR135-6, GA_x6K02T2P1NL-3932085-3931147
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73774849-73780713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73776546 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 260 (L260F)
Ref Sequence ENSEMBL: ENSMUSP00000149734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122224] [ENSMUST00000124927] [ENSMUST00000215418]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118611
Predicted Effect probably benign
Transcript: ENSMUST00000122224
AA Change: L260F

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113364
Gene: ENSMUSG00000070383
AA Change: L260F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124927
AA Change: L260F

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115639
Gene: ENSMUSG00000070383
AA Change: L260F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 221 6.6e-7 PFAM
Pfam:7tm_1 41 224 3.5e-29 PFAM
Pfam:7tm_4 139 224 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215418
AA Change: L260F

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tcerg1 T C 18: 42,523,981 M176T unknown Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Olfr389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Olfr389 APN 11 73776706 missense probably benign 0.44
IGL01766:Olfr389 APN 11 73777075 missense probably benign 0.41
IGL01771:Olfr389 APN 11 73776664 missense probably damaging 1.00
IGL02535:Olfr389 APN 11 73776616 missense probably benign 0.00
IGL02639:Olfr389 APN 11 73776545 missense probably benign 0.21
IGL03060:Olfr389 APN 11 73776463 missense probably damaging 1.00
IGL03075:Olfr389 APN 11 73776472 missense probably damaging 1.00
R0081:Olfr389 UTSW 11 73777109 missense possibly damaging 0.59
R0426:Olfr389 UTSW 11 73776437 missense probably benign 0.13
R1140:Olfr389 UTSW 11 73776854 missense probably benign
R1638:Olfr389 UTSW 11 73777148 missense possibly damaging 0.95
R2001:Olfr389 UTSW 11 73776713 missense probably benign
R2214:Olfr389 UTSW 11 73776829 nonsense probably null
R3076:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3077:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3078:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3081:Olfr389 UTSW 11 73777225 missense probably damaging 1.00
R3430:Olfr389 UTSW 11 73776539 missense probably damaging 1.00
R3731:Olfr389 UTSW 11 73776739 missense probably benign 0.08
R4090:Olfr389 UTSW 11 73776841 missense probably damaging 1.00
R4303:Olfr389 UTSW 11 73776838 missense possibly damaging 0.78
R4516:Olfr389 UTSW 11 73777040 missense probably benign 0.06
R4556:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4557:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4775:Olfr389 UTSW 11 73776551 missense probably damaging 1.00
R5015:Olfr389 UTSW 11 73777181 missense probably benign 0.07
R5087:Olfr389 UTSW 11 73777258 missense possibly damaging 0.75
R6599:Olfr389 UTSW 11 73776680 missense probably benign
R6701:Olfr389 UTSW 11 73776470 missense probably damaging 1.00
R6784:Olfr389 UTSW 11 73776850 missense probably damaging 1.00
R6916:Olfr389 UTSW 11 73777069 missense probably benign 0.00
R7066:Olfr389 UTSW 11 73777192 missense probably damaging 0.99
R7226:Olfr389 UTSW 11 73776677 missense possibly damaging 0.95
R7457:Olfr389 UTSW 11 73776826 missense probably benign 0.06
R7486:Olfr389 UTSW 11 73777021 missense probably damaging 1.00
R7990:Olfr389 UTSW 11 73776671 missense probably benign 0.00
R8289:Olfr389 UTSW 11 73777013 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCCTTGTAGGTCCTATGATGAG -3'
(R):5'- CTTCTGAAGTTGTCTTGCTCAG -3'

Sequencing Primer
(F):5'- GGTCCTATGATGAGAGACAATATCTG -3'
(R):5'- GCTCAGACACTTTTGTTAATGAGTTG -3'
Posted On2016-03-01