Incidental Mutation 'R4858:Tcerg1'
ID372278
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
MMRRC Submission 042469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4858 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42523981 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 176 (M176T)
Ref Sequence ENSEMBL: ENSMUSP00000134458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
Predicted Effect unknown
Transcript: ENSMUST00000025375
AA Change: M176T
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: M176T

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173642
AA Change: M176T
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: M176T

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,349,577 Y1415C probably damaging Het
Adgrf1 T C 17: 43,303,672 S216P probably damaging Het
Ankrd12 T C 17: 66,031,433 D197G probably damaging Het
Aoc3 C A 11: 101,331,662 H198Q probably damaging Het
Aox1 C A 1: 58,104,481 H1253N probably benign Het
Arg1 T A 10: 24,922,638 E38V possibly damaging Het
Baz2b T A 2: 59,907,743 M1741L probably benign Het
Bend4 T C 5: 67,417,572 E322G probably damaging Het
Brpf1 T C 6: 113,317,678 V661A possibly damaging Het
C2cd3 A T 7: 100,454,953 T2058S probably damaging Het
Camk4 T C 18: 33,176,213 V223A probably damaging Het
Casp1 C T 9: 5,306,742 R395C probably damaging Het
Ccdc180 T G 4: 45,923,244 I1066S probably damaging Het
Ccne1 A G 7: 38,099,319 F292L probably damaging Het
Ccz1 A T 5: 144,012,810 M100K probably damaging Het
Cep128 T C 12: 91,260,162 T678A probably benign Het
Cep290 G A 10: 100,494,911 R151Q probably benign Het
Crip3 A G 17: 46,430,747 probably benign Het
Ddx60 A G 8: 62,021,314 M1479V possibly damaging Het
Defb40 T A 8: 18,975,077 I38F probably benign Het
Diexf A G 1: 193,113,764 Y686H probably damaging Het
Dnajb2 C T 1: 75,243,554 T221I possibly damaging Het
Dpcr1 G A 17: 35,637,576 T377I possibly damaging Het
Dpysl3 T C 18: 43,334,014 I279V probably damaging Het
Echs1 G A 7: 140,112,586 probably benign Het
Efl1 T A 7: 82,671,627 N89K probably damaging Het
Extl3 T C 14: 65,075,994 T580A probably benign Het
Fam171a2 C T 11: 102,440,156 G193E probably damaging Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fbxw20 A T 9: 109,234,695 V3D possibly damaging Het
Fig4 G A 10: 41,233,590 P637L probably benign Het
Fnbp1l G A 3: 122,546,315 T496I probably benign Het
Fry T C 5: 150,401,643 V1175A possibly damaging Het
Gm5617 C T 9: 48,495,668 A34V possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
H2-K1 A T 17: 33,997,324 Y283N probably benign Het
Hectd2 A T 19: 36,605,282 I471F probably damaging Het
Hsdl2 T C 4: 59,612,812 probably null Het
Igkv3-1 T C 6: 70,704,044 S76P probably damaging Het
Krt15 A T 11: 100,132,071 S439R probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lima1 G A 15: 99,819,576 T23I probably benign Het
Map4k1 C A 7: 28,988,770 H248Q probably damaging Het
Mcf2l C A 8: 13,013,972 T1004K probably damaging Het
Micall1 T A 15: 79,122,946 probably benign Het
Ms4a14 A G 19: 11,301,612 I1194T probably benign Het
Mtor T C 4: 148,454,816 *257Q probably null Het
Ncan T A 8: 70,104,055 T961S probably benign Het
Olfr1100 T G 2: 86,978,349 Y149S probably damaging Het
Olfr161 T C 16: 3,592,842 S149P probably damaging Het
Olfr311 T A 11: 58,841,207 L31H possibly damaging Het
Olfr331 T A 11: 58,501,909 I216F probably damaging Het
Olfr389 T A 11: 73,776,546 L260F probably benign Het
Olfr419 A T 1: 174,250,696 I77N probably damaging Het
Pcdhgb2 A G 18: 37,692,100 R715G probably benign Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pkhd1l1 A T 15: 44,491,101 D296V probably damaging Het
Plekhh2 A G 17: 84,600,697 I1189V probably damaging Het
Psg18 A T 7: 18,353,484 L83Q possibly damaging Het
Rps6kc1 A G 1: 190,800,318 W496R probably damaging Het
Setd5 C T 6: 113,149,566 T1188I probably damaging Het
Slc4a3 T C 1: 75,555,085 F899L probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Speg G T 1: 75,421,735 R1942L probably damaging Het
Sulf2 C A 2: 166,081,604 R565L probably benign Het
Tfcp2l1 T C 1: 118,669,509 I440T possibly damaging Het
Tgm7 A T 2: 121,098,964 probably null Het
Tjp2 C A 19: 24,122,120 G433V probably damaging Het
Tldc1 T G 8: 119,772,523 T77P probably benign Het
Tmc7 C T 7: 118,543,342 G608R probably damaging Het
Tmed4 A G 11: 6,274,456 F68S possibly damaging Het
Tmem30b G A 12: 73,545,912 P143L probably damaging Het
Tnfrsf23 C T 7: 143,681,480 C49Y probably damaging Het
Tnni3k A T 3: 154,786,808 probably null Het
Trav12-2 G T 14: 53,616,693 M41I probably benign Het
Trim6 T A 7: 104,232,485 Y314* probably null Het
Ttc25 A G 11: 100,550,321 N126S probably damaging Het
Vmn2r118 A G 17: 55,592,894 V670A probably damaging Het
Zfp438 A T 18: 5,213,154 D601E probably benign Het
Zfp606 T A 7: 12,493,056 I310N possibly damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42524008 missense unknown
R0138:Tcerg1 UTSW 18 42568614 splice site probably benign
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R5371:Tcerg1 UTSW 18 42519535 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 splice site probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
R7147:Tcerg1 UTSW 18 42550063 missense probably benign 0.22
R7714:Tcerg1 UTSW 18 42560935 missense possibly damaging 0.77
R7739:Tcerg1 UTSW 18 42523974 missense unknown
R7838:Tcerg1 UTSW 18 42536937 missense probably benign 0.01
R8204:Tcerg1 UTSW 18 42574553 missense probably damaging 1.00
R8293:Tcerg1 UTSW 18 42560955 missense probably benign 0.03
R8300:Tcerg1 UTSW 18 42550072 missense probably benign 0.22
R8426:Tcerg1 UTSW 18 42548401 missense possibly damaging 0.68
R8514:Tcerg1 UTSW 18 42564122 missense probably damaging 0.98
R8672:Tcerg1 UTSW 18 42553494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTGTCAGGCCTTCTTTGTTAAC -3'
(R):5'- AGTTGACGTGGACACTGCAG -3'

Sequencing Primer
(F):5'- CTTCCTGCACAAAATATGACATTG -3'
(R):5'- AGCGCCTACTGCTTGTG -3'
Posted On2016-03-01