Incidental Mutation 'R4859:Aldh16a1'
ID 372320
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 042470-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4859 (G1)
Quality Score 210
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44796731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 256 (R256H)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362] [ENSMUST00000209957]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000007977
AA Change: R256H

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000007977
Gene: ENSMUSG00000007833
AA Change: R256H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 1.1e-84 PFAM
Pfam:Aldedh 537 774 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107815
AA Change: R256H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: R256H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126618
AA Change: R392H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209963
AA Change: R256H

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect silent
Transcript: ENSMUST00000210125
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Meta Mutation Damage Score 0.6139 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 41,207,580 (GRCm39) V282E probably benign Het
Adam26b T C 8: 43,973,296 (GRCm39) T569A possibly damaging Het
Adam6a A G 12: 113,509,609 (GRCm39) N661D probably damaging Het
Adck1 G A 12: 88,407,865 (GRCm39) A199T probably benign Het
Adhfe1 A G 1: 9,628,438 (GRCm39) Y270C probably damaging Het
Ap5z1 T C 5: 142,459,748 (GRCm39) M466T possibly damaging Het
Aspm C T 1: 139,397,131 (GRCm39) L908F probably damaging Het
Atp8b2 T A 3: 89,853,287 (GRCm39) T743S probably benign Het
Bag2 G T 1: 33,786,022 (GRCm39) T100K probably damaging Het
Camk2a A G 18: 61,076,246 (GRCm39) probably benign Het
Ccdc158 A G 5: 92,781,262 (GRCm39) Y848H probably damaging Het
Ccp110 T G 7: 118,324,653 (GRCm39) V725G possibly damaging Het
Cdh6 A G 15: 13,051,418 (GRCm39) V405A probably benign Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cfap157 A G 2: 32,667,554 (GRCm39) F510L probably benign Het
Chd3 A T 11: 69,250,722 (GRCm39) M669K possibly damaging Het
Cnot10 C T 9: 114,456,532 (GRCm39) A168T probably damaging Het
Crybg1 A G 10: 43,868,565 (GRCm39) V1371A probably damaging Het
Dars2 A G 1: 160,872,560 (GRCm39) L547P probably damaging Het
Dis3 A G 14: 99,325,226 (GRCm39) C483R probably damaging Het
Dnah7b T A 1: 46,395,762 (GRCm39) L3888Q probably damaging Het
Dpysl2 A T 14: 67,066,888 (GRCm39) Y182N probably damaging Het
Eif4g1 T A 16: 20,500,923 (GRCm39) F509L probably benign Het
Evc T C 5: 37,458,253 (GRCm39) T85A probably damaging Het
Farsb T C 1: 78,444,609 (GRCm39) T283A probably benign Het
Fem1al G T 11: 29,775,178 (GRCm39) A93E probably damaging Het
Fgf14 C A 14: 124,429,845 (GRCm39) R30L possibly damaging Het
Gbe1 T C 16: 70,275,289 (GRCm39) L363P probably damaging Het
Gcg A G 2: 62,307,189 (GRCm39) V124A probably damaging Het
Glb1l A G 1: 75,176,963 (GRCm39) probably benign Het
Gm5431 T C 11: 48,780,409 (GRCm39) E449G probably damaging Het
Gon4l T C 3: 88,802,655 (GRCm39) S1089P probably benign Het
Hgd T C 16: 37,409,111 (GRCm39) L25P probably damaging Het
Hnf1a T C 5: 115,093,311 (GRCm39) H318R possibly damaging Het
Hsd17b7 A C 1: 169,794,826 (GRCm39) V71G possibly damaging Het
Hydin T C 8: 111,233,126 (GRCm39) S1742P possibly damaging Het
Insyn2b A G 11: 34,353,154 (GRCm39) S399G probably benign Het
Kank2 T C 9: 21,691,078 (GRCm39) E552G probably benign Het
Kcnq4 C A 4: 120,573,810 (GRCm39) R217L probably damaging Het
Klrg2 T C 6: 38,604,540 (GRCm39) *201W probably null Het
Kndc1 T C 7: 139,501,821 (GRCm39) S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Lonp1 A G 17: 56,933,587 (GRCm39) V96A probably benign Het
Mgat4e T C 1: 134,469,478 (GRCm39) K189E possibly damaging Het
Msantd5f8 A G 4: 73,805,457 (GRCm39) S351P probably damaging Het
Msh2 G A 17: 88,026,187 (GRCm39) V722I possibly damaging Het
Mtcl3 A C 10: 29,026,390 (GRCm39) M491L probably benign Het
N4bp2 T C 5: 65,982,641 (GRCm39) Y1632H probably damaging Het
Nlrc4 T G 17: 74,743,032 (GRCm39) K862T probably damaging Het
Notch4 A T 17: 34,806,154 (GRCm39) Q1750L probably damaging Het
Obscn C T 11: 58,972,849 (GRCm39) V2066I possibly damaging Het
Or2v2 T C 11: 49,003,993 (GRCm39) K187E probably damaging Het
Or4c15 T A 2: 88,760,627 (GRCm39) I11L probably benign Het
Or4f14b A T 2: 111,775,156 (GRCm39) I215N probably damaging Het
Or52d13 A T 7: 103,110,243 (GRCm39) Y57* probably null Het
Or5m8 T C 2: 85,823,075 (GRCm39) S305P probably damaging Het
Pde7a T A 3: 19,295,655 (GRCm39) probably benign Het
Pign A T 1: 105,575,892 (GRCm39) Y249* probably null Het
Ppp1r17 A T 6: 56,003,449 (GRCm39) E87D probably damaging Het
Prss3 T A 6: 41,350,857 (GRCm39) Q211L probably damaging Het
Rapgef6 A G 11: 54,526,989 (GRCm39) E413G probably benign Het
Rnf150 A G 8: 83,590,712 (GRCm39) H25R probably damaging Het
Scamp2 T C 9: 57,488,934 (GRCm39) probably null Het
Scap T A 9: 110,203,410 (GRCm39) probably benign Het
Sdc2 A C 15: 33,032,602 (GRCm39) K175N probably damaging Het
Serpinb6d T A 13: 33,851,547 (GRCm39) probably null Het
Sh3tc2 A G 18: 62,146,164 (GRCm39) N1181S probably benign Het
Slc44a2 T C 9: 21,259,441 (GRCm39) I46T probably damaging Het
Slfn8 A G 11: 82,908,540 (GRCm39) M1T probably null Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Spata1 C G 3: 146,175,529 (GRCm39) D326H probably damaging Het
Tbck T G 3: 132,507,288 (GRCm39) S753R probably benign Het
Tdp1 A G 12: 99,876,070 (GRCm39) I340M probably benign Het
Tmprss6 T A 15: 78,330,877 (GRCm39) Y50F probably damaging Het
Trank1 T A 9: 111,194,078 (GRCm39) S701T probably benign Het
Trbv17 A T 6: 41,140,223 (GRCm39) N26I probably benign Het
Trip12 A T 1: 84,771,531 (GRCm39) S248T probably damaging Het
Vmn2r53 T G 7: 12,335,330 (GRCm39) Q110P probably damaging Het
Vmn2r75 A G 7: 85,797,611 (GRCm39) V734A probably benign Het
Wfdc11 A T 2: 164,507,415 (GRCm39) M14K probably null Het
Xcr1 T A 9: 123,685,712 (GRCm39) M17L probably benign Het
Zbtb40 A G 4: 136,716,070 (GRCm39) I965T probably damaging Het
Zfp760 A T 17: 21,942,511 (GRCm39) H562L probably damaging Het
Zfp760 A T 17: 21,942,516 (GRCm39) R564* probably null Het
Znf41-ps T A 4: 145,555,283 (GRCm39) noncoding transcript Het
Zyg11a A T 4: 108,067,387 (GRCm39) I41N probably damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TATTTGGAGAGATATGGCGGACCC -3'
(R):5'- TCTTTCCCAGGGATCCTCAATG -3'

Sequencing Primer
(F):5'- ATATGGCGGACCCCTGAACTTTG -3'
(R):5'- CCCAGGGATCCTCAATGTGGTATG -3'
Posted On 2016-03-01