Mutagenetix > Incidental Mutations

Incidental Mutation 'R0239:Cdh12'

37233

Institutional Source

Beutler Lab

Gene Symbol

Cdh12

Ensembl Gene

ENSMUSG00000040452

Gene Name

cadherin 12

Synonyms

Br-cadherin

MMRRC Submission

038477-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.229) question?

Stock #

R0239 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20449265-21589533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21586407 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 771 (W771R)

Ref Sequence

ENSEMBL: ENSMUSP00000153750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075132
AA Change: W771R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: W771R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
CA	77	158	5.18e-18	SMART
CA	182	267	4.4e-30	SMART
CA	291	383	2.42e-18	SMART
CA	406	487	7.55e-20	SMART
CA	510	597	9.3e-2	SMART
transmembrane domain	615	637	N/A	INTRINSIC
Pfam:Cadherin_C	640	784	1.7e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227496
AA Change: W771R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9354

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.9%

Validation Efficiency

100% (3/3)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	TTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCC	3: 138,065,834		probably benign	Het
Adra1d	C	A	2: 131,546,214	V474F	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Ash1l	A	G	3: 89,067,222	D2618G	possibly damaging	Het
Atp6v1c2	C	A	12: 17,294,675		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Camta1	A	G	4: 151,143,730	W882R	probably damaging	Het
Cd72	A	G	4: 43,453,163	V91A	probably benign	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,878	Y150C	probably damaging	Het
Depdc5	T	C	5: 32,943,240	S832P	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Espnl	T	C	1: 91,322,287	V52A	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gemin6	C	A	17: 80,225,710	A24D	probably damaging	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm9733	A	G	3: 15,296,601	L163P	probably damaging	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hyal5	T	A	6: 24,876,344	L72Q	probably damaging	Het
Ift140	C	A	17: 25,045,523	C557*	probably null	Het
Ikbkap	C	A	4: 56,784,596	V466L	probably benign	Het
Kbtbd3	G	T	9: 4,330,144	V173L	possibly damaging	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nacc2	T	G	2: 26,062,261	N361T	probably damaging	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nipal4	A	G	11: 46,150,441	V309A	possibly damaging	Het
Nomo1	T	C	7: 46,079,594		probably null	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Nwd2	A	T	5: 63,800,124	I266F	probably benign	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pah	C	T	10: 87,567,281	P173S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plekha4	A	G	7: 45,532,358	H62R	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Ptk2	A	T	15: 73,343,283		probably null	Het
Raet1e	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Scai	T	A	2: 39,075,042	I597F	probably benign	Het
Slc35c2	C	T	2: 165,280,837	G176S	probably damaging	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Tbc1d31	C	A	15: 57,940,753	T388N	probably benign	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tmem79	A	G	3: 88,333,321	S107P	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Tsnaxip1	T	A	8: 105,844,488	I660N	possibly damaging	Het
Ube2q2	T	C	9: 55,163,007	S78P	probably damaging	Het
Vac14	A	T	8: 110,635,375		probably null	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp532	A	T	18: 65,682,985	I810F	possibly damaging	Het
Zfp599	C	T	9: 22,249,759	C370Y	probably damaging	Het

Other mutations in Cdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01351:Cdh12	APN	15	21237903	missense	probably damaging	0.98
IGL01414:Cdh12	APN	15	21492689	missense	probably damaging	1.00
IGL02088:Cdh12	APN	15	21480339	nonsense	probably null
IGL02894:Cdh12	APN	15	21586294	missense	probably damaging	1.00
IGL03008:Cdh12	APN	15	21480330	missense	probably damaging	0.98
IGL03271:Cdh12	APN	15	21586453	missense	probably benign	0.19
IGL03402:Cdh12	APN	15	21583740	missense	probably benign	0.08
R0042:Cdh12	UTSW	15	21537677	splice site	probably benign
R0126:Cdh12	UTSW	15	21583945	missense	probably benign
R0239:Cdh12	UTSW	15	21586407	missense	probably damaging	1.00
R0335:Cdh12	UTSW	15	21578549	critical splice donor site	probably null
R0421:Cdh12	UTSW	15	21480224	critical splice acceptor site	probably null
R0918:Cdh12	UTSW	15	21492599	missense	probably damaging	0.99
R0972:Cdh12	UTSW	15	21237764	missense	probably benign	0.27
R1014:Cdh12	UTSW	15	21492620	missense	probably damaging	0.97
R1304:Cdh12	UTSW	15	21583937	missense	probably benign	0.10
R1677:Cdh12	UTSW	15	21520405	missense	probably damaging	0.99
R1735:Cdh12	UTSW	15	21520366	missense	probably damaging	1.00
R1916:Cdh12	UTSW	15	21520250	splice site	probably null
R1950:Cdh12	UTSW	15	21237879	missense	probably damaging	1.00
R2059:Cdh12	UTSW	15	21583740	missense	probably benign	0.08
R2157:Cdh12	UTSW	15	21583787	missense	possibly damaging	0.84
R2404:Cdh12	UTSW	15	21537634	missense	probably damaging	1.00
R3625:Cdh12	UTSW	15	21358756	missense	probably damaging	1.00
R3703:Cdh12	UTSW	15	21583826	missense	probably damaging	0.97
R3704:Cdh12	UTSW	15	21583826	missense	probably damaging	0.97
R3743:Cdh12	UTSW	15	21537659	missense	probably damaging	0.98
R3771:Cdh12	UTSW	15	21578554	splice site	probably benign
R3780:Cdh12	UTSW	15	21585977	splice site	probably null
R4750:Cdh12	UTSW	15	21583808	missense	possibly damaging	0.59
R5373:Cdh12	UTSW	15	21583912	missense	probably damaging	1.00
R5374:Cdh12	UTSW	15	21583912	missense	probably damaging	1.00
R5443:Cdh12	UTSW	15	21237849	missense	probably benign	0.01
R5548:Cdh12	UTSW	15	21492654	missense	probably damaging	1.00
R5746:Cdh12	UTSW	15	21358724	missense	probably null	1.00
R5960:Cdh12	UTSW	15	21492476	intron	probably null
R6248:Cdh12	UTSW	15	21237714	missense	possibly damaging	0.82
R6379:Cdh12	UTSW	15	21492657	missense	probably benign	0.02
R6419:Cdh12	UTSW	15	21520397	missense	probably damaging	0.99
R6561:Cdh12	UTSW	15	21492594	missense	probably damaging	1.00
R6901:Cdh12	UTSW	15	21583786	missense	probably benign	0.01
R7025:Cdh12	UTSW	15	21358814	missense	probably damaging	1.00
R7070:Cdh12	UTSW	15	21583829	missense	probably benign	0.38
R7508:Cdh12	UTSW	15	21583765	missense	probably benign
X0065:Cdh12	UTSW	15	21358765	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGTCAAAGACCACAAGTGGAAGAC -3'
(R):5'- TCTTGTCCTGCAAAATCTGGGAGTG -3'

Sequencing Primer
(F):5'- CACAGACATAAGGGATTTTATTCACC -3'
(R):5'- CAAAATCTGGGAgtgtgtgtg -3'

Posted On

2013-05-09