Incidental Mutation 'R4859:4931440F15Rik'
ID 372339
Institutional Source Beutler Lab
Gene Symbol 4931440F15Rik
Ensembl Gene ENSMUSG00000078157
Gene Name RIKEN cDNA 4931440F15 gene
Synonyms
MMRRC Submission 042470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4859 (G1)
Quality Score 101
Status Validated
Chromosome 11
Chromosomal Location 29822395-29825668 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 29825178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 93 (A93E)
Ref Sequence ENSEMBL: ENSMUSP00000100568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]
AlphaFold Q8C0T1
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000104962
AA Change: A93E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157
AA Change: A93E

DomainStartEndE-ValueType
ANK 19 50 1.53e3 SMART
ANK 57 87 1.7e-3 SMART
ANK 99 128 3.6e-2 SMART
ANK 132 162 3.31e-1 SMART
ANK 166 195 8.19e-6 SMART
ANK 199 228 7.83e-3 SMART
ANK 231 260 1.8e-2 SMART
low complexity region 297 306 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
ANK 536 578 8.39e-3 SMART
ANK 582 611 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in 4931440F15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:4931440F15Rik APN 11 29824755 missense probably damaging 1.00
IGL01560:4931440F15Rik APN 11 29824643 nonsense probably null
IGL02160:4931440F15Rik APN 11 29823593 nonsense probably null
IGL03058:4931440F15Rik APN 11 29824656 missense probably benign 0.01
IGL03107:4931440F15Rik APN 11 29824360 missense probably damaging 1.00
R0504:4931440F15Rik UTSW 11 29824990 missense probably damaging 1.00
R0615:4931440F15Rik UTSW 11 29824515 missense probably damaging 1.00
R1167:4931440F15Rik UTSW 11 29823567 missense probably damaging 1.00
R1329:4931440F15Rik UTSW 11 29823553 missense probably benign 0.01
R1525:4931440F15Rik UTSW 11 29823994 missense probably benign 0.11
R1745:4931440F15Rik UTSW 11 29824723 missense probably benign
R1917:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R1918:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R2338:4931440F15Rik UTSW 11 29823718 missense probably benign 0.01
R4359:4931440F15Rik UTSW 11 29824669 missense probably benign 0.12
R4757:4931440F15Rik UTSW 11 29825454 start codon destroyed probably null 1.00
R5595:4931440F15Rik UTSW 11 29824288 missense probably benign 0.00
R7084:4931440F15Rik UTSW 11 29825009 missense probably damaging 0.99
R7447:4931440F15Rik UTSW 11 29824122 missense probably benign
R8098:4931440F15Rik UTSW 11 29824450 missense possibly damaging 0.78
R8825:4931440F15Rik UTSW 11 29823696 missense probably benign 0.00
R9389:4931440F15Rik UTSW 11 29825107 missense probably damaging 1.00
R9418:4931440F15Rik UTSW 11 29824632 missense probably damaging 0.98
R9784:4931440F15Rik UTSW 11 29825253 missense probably damaging 1.00
Z1088:4931440F15Rik UTSW 11 29825007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCATAAGGCACGTGTGG -3'
(R):5'- CTGCTGCAGAAACTGTTGG -3'

Sequencing Primer
(F):5'- TGTGGCCGTGGCGATTG -3'
(R):5'- TGCAGAAACTGTTGGCCAGC -3'
Posted On 2016-03-01