Incidental Mutation 'R4859:Olfr1396'
ID372342
Institutional Source Beutler Lab
Gene Symbol Olfr1396
Ensembl Gene ENSMUSG00000047511
Gene Nameolfactory receptor 1396
SynonymsGA_x6K02T2QP88-6321048-6321995, MOR276-2
MMRRC Submission 042470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4859 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49109982-49114874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49113166 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 187 (K187E)
Ref Sequence ENSEMBL: ENSMUSP00000150961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000060398] [ENSMUST00000102785] [ENSMUST00000109201] [ENSMUST00000179282] [ENSMUST00000203007] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000215553]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060398
AA Change: K187E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056876
Gene: ENSMUSG00000047511
AA Change: K187E

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 3.2e-46 PFAM
Pfam:7tm_1 53 302 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109201
AA Change: K187E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104824
Gene: ENSMUSG00000047511
AA Change: K187E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 4e-35 PFAM
Pfam:7tm_4 140 284 5.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203007
AA Change: K187E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145057
Gene: ENSMUSG00000047511
AA Change: K187E

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 9.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203412
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215553
AA Change: K187E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Olfr1396
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1396 APN 11 49112853 missense probably damaging 1.00
IGL01514:Olfr1396 APN 11 49113576 missense probably damaging 1.00
IGL03188:Olfr1396 APN 11 49113709 missense probably damaging 1.00
R0314:Olfr1396 UTSW 11 49113692 missense possibly damaging 0.54
R1242:Olfr1396 UTSW 11 49112901 missense possibly damaging 0.95
R1625:Olfr1396 UTSW 11 49113244 missense probably benign 0.01
R2212:Olfr1396 UTSW 11 49113216 missense probably damaging 1.00
R4290:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4291:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4292:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4294:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4295:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4351:Olfr1396 UTSW 11 49113703 missense probably damaging 0.99
R4817:Olfr1396 UTSW 11 49113621 missense probably damaging 1.00
R5245:Olfr1396 UTSW 11 49113289 missense probably benign 0.12
R5350:Olfr1396 UTSW 11 49113052 missense probably benign 0.00
R6625:Olfr1396 UTSW 11 49113069 missense probably damaging 1.00
R7529:Olfr1396 UTSW 11 49112859 missense probably damaging 1.00
X0024:Olfr1396 UTSW 11 49113311 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AAGAGACAGCTGCCATGTGG -3'
(R):5'- ACTCATGGCTTATGATCGCTATG -3'

Sequencing Primer
(F):5'- TGCCATGTGGGAGGAACAG -3'
(R):5'- ATCGCTATGTGGCCATTAGC -3'
Posted On2016-03-01