Incidental Mutation 'R4859:Rapgef6'
ID 372343
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 042470-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4859 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54526989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 413 (E413G)
Ref Sequence ENSEMBL: ENSMUSP00000151509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000108895] [ENSMUST00000207429] [ENSMUST00000218995]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: E275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: E275G

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: E560G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: E560G

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
AA Change: E275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: E275G

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149372
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: E560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218995
AA Change: E413G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220269
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 41,207,580 (GRCm39) V282E probably benign Het
Adam26b T C 8: 43,973,296 (GRCm39) T569A possibly damaging Het
Adam6a A G 12: 113,509,609 (GRCm39) N661D probably damaging Het
Adck1 G A 12: 88,407,865 (GRCm39) A199T probably benign Het
Adhfe1 A G 1: 9,628,438 (GRCm39) Y270C probably damaging Het
Aldh16a1 C T 7: 44,796,731 (GRCm39) R256H probably benign Het
Ap5z1 T C 5: 142,459,748 (GRCm39) M466T possibly damaging Het
Aspm C T 1: 139,397,131 (GRCm39) L908F probably damaging Het
Atp8b2 T A 3: 89,853,287 (GRCm39) T743S probably benign Het
Bag2 G T 1: 33,786,022 (GRCm39) T100K probably damaging Het
Camk2a A G 18: 61,076,246 (GRCm39) probably benign Het
Ccdc158 A G 5: 92,781,262 (GRCm39) Y848H probably damaging Het
Ccp110 T G 7: 118,324,653 (GRCm39) V725G possibly damaging Het
Cdh6 A G 15: 13,051,418 (GRCm39) V405A probably benign Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cfap157 A G 2: 32,667,554 (GRCm39) F510L probably benign Het
Chd3 A T 11: 69,250,722 (GRCm39) M669K possibly damaging Het
Cnot10 C T 9: 114,456,532 (GRCm39) A168T probably damaging Het
Crybg1 A G 10: 43,868,565 (GRCm39) V1371A probably damaging Het
Dars2 A G 1: 160,872,560 (GRCm39) L547P probably damaging Het
Dis3 A G 14: 99,325,226 (GRCm39) C483R probably damaging Het
Dnah7b T A 1: 46,395,762 (GRCm39) L3888Q probably damaging Het
Dpysl2 A T 14: 67,066,888 (GRCm39) Y182N probably damaging Het
Eif4g1 T A 16: 20,500,923 (GRCm39) F509L probably benign Het
Evc T C 5: 37,458,253 (GRCm39) T85A probably damaging Het
Farsb T C 1: 78,444,609 (GRCm39) T283A probably benign Het
Fem1al G T 11: 29,775,178 (GRCm39) A93E probably damaging Het
Fgf14 C A 14: 124,429,845 (GRCm39) R30L possibly damaging Het
Gbe1 T C 16: 70,275,289 (GRCm39) L363P probably damaging Het
Gcg A G 2: 62,307,189 (GRCm39) V124A probably damaging Het
Glb1l A G 1: 75,176,963 (GRCm39) probably benign Het
Gm5431 T C 11: 48,780,409 (GRCm39) E449G probably damaging Het
Gon4l T C 3: 88,802,655 (GRCm39) S1089P probably benign Het
Hgd T C 16: 37,409,111 (GRCm39) L25P probably damaging Het
Hnf1a T C 5: 115,093,311 (GRCm39) H318R possibly damaging Het
Hsd17b7 A C 1: 169,794,826 (GRCm39) V71G possibly damaging Het
Hydin T C 8: 111,233,126 (GRCm39) S1742P possibly damaging Het
Insyn2b A G 11: 34,353,154 (GRCm39) S399G probably benign Het
Kank2 T C 9: 21,691,078 (GRCm39) E552G probably benign Het
Kcnq4 C A 4: 120,573,810 (GRCm39) R217L probably damaging Het
Klrg2 T C 6: 38,604,540 (GRCm39) *201W probably null Het
Kndc1 T C 7: 139,501,821 (GRCm39) S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Lonp1 A G 17: 56,933,587 (GRCm39) V96A probably benign Het
Mgat4e T C 1: 134,469,478 (GRCm39) K189E possibly damaging Het
Msantd5f8 A G 4: 73,805,457 (GRCm39) S351P probably damaging Het
Msh2 G A 17: 88,026,187 (GRCm39) V722I possibly damaging Het
Mtcl3 A C 10: 29,026,390 (GRCm39) M491L probably benign Het
N4bp2 T C 5: 65,982,641 (GRCm39) Y1632H probably damaging Het
Nlrc4 T G 17: 74,743,032 (GRCm39) K862T probably damaging Het
Notch4 A T 17: 34,806,154 (GRCm39) Q1750L probably damaging Het
Obscn C T 11: 58,972,849 (GRCm39) V2066I possibly damaging Het
Or2v2 T C 11: 49,003,993 (GRCm39) K187E probably damaging Het
Or4c15 T A 2: 88,760,627 (GRCm39) I11L probably benign Het
Or4f14b A T 2: 111,775,156 (GRCm39) I215N probably damaging Het
Or52d13 A T 7: 103,110,243 (GRCm39) Y57* probably null Het
Or5m8 T C 2: 85,823,075 (GRCm39) S305P probably damaging Het
Pde7a T A 3: 19,295,655 (GRCm39) probably benign Het
Pign A T 1: 105,575,892 (GRCm39) Y249* probably null Het
Ppp1r17 A T 6: 56,003,449 (GRCm39) E87D probably damaging Het
Prss3 T A 6: 41,350,857 (GRCm39) Q211L probably damaging Het
Rnf150 A G 8: 83,590,712 (GRCm39) H25R probably damaging Het
Scamp2 T C 9: 57,488,934 (GRCm39) probably null Het
Scap T A 9: 110,203,410 (GRCm39) probably benign Het
Sdc2 A C 15: 33,032,602 (GRCm39) K175N probably damaging Het
Serpinb6d T A 13: 33,851,547 (GRCm39) probably null Het
Sh3tc2 A G 18: 62,146,164 (GRCm39) N1181S probably benign Het
Slc44a2 T C 9: 21,259,441 (GRCm39) I46T probably damaging Het
Slfn8 A G 11: 82,908,540 (GRCm39) M1T probably null Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Spata1 C G 3: 146,175,529 (GRCm39) D326H probably damaging Het
Tbck T G 3: 132,507,288 (GRCm39) S753R probably benign Het
Tdp1 A G 12: 99,876,070 (GRCm39) I340M probably benign Het
Tmprss6 T A 15: 78,330,877 (GRCm39) Y50F probably damaging Het
Trank1 T A 9: 111,194,078 (GRCm39) S701T probably benign Het
Trbv17 A T 6: 41,140,223 (GRCm39) N26I probably benign Het
Trip12 A T 1: 84,771,531 (GRCm39) S248T probably damaging Het
Vmn2r53 T G 7: 12,335,330 (GRCm39) Q110P probably damaging Het
Vmn2r75 A G 7: 85,797,611 (GRCm39) V734A probably benign Het
Wfdc11 A T 2: 164,507,415 (GRCm39) M14K probably null Het
Xcr1 T A 9: 123,685,712 (GRCm39) M17L probably benign Het
Zbtb40 A G 4: 136,716,070 (GRCm39) I965T probably damaging Het
Zfp760 A T 17: 21,942,511 (GRCm39) H562L probably damaging Het
Zfp760 A T 17: 21,942,516 (GRCm39) R564* probably null Het
Znf41-ps T A 4: 145,555,283 (GRCm39) noncoding transcript Het
Zyg11a A T 4: 108,067,387 (GRCm39) I41N probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54,582,134 (GRCm39) missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGTTCTAATGCTAACCATTGAAG -3'
(R):5'- CTTGGTTGGAAAAGTGAGGACC -3'

Sequencing Primer
(F):5'- GCCTGTAAGAATAGGTACATACATG -3'
(R):5'- CTAGCCAATCGGTAAGTTCCAGG -3'
Posted On 2016-03-01