Incidental Mutation 'R4859:Slfn8'
ID 372346
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 042470-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4859 (G1)
Quality Score 223
Status Not validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 82908540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect probably null
Transcript: ENSMUST00000038141
AA Change: M1T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092838
AA Change: M1T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108152
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130822
AA Change: M1T

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: M1T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131883
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215239
AA Change: M1T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 T A 8: 41,207,580 (GRCm39) V282E probably benign Het
Adam26b T C 8: 43,973,296 (GRCm39) T569A possibly damaging Het
Adam6a A G 12: 113,509,609 (GRCm39) N661D probably damaging Het
Adck1 G A 12: 88,407,865 (GRCm39) A199T probably benign Het
Adhfe1 A G 1: 9,628,438 (GRCm39) Y270C probably damaging Het
Aldh16a1 C T 7: 44,796,731 (GRCm39) R256H probably benign Het
Ap5z1 T C 5: 142,459,748 (GRCm39) M466T possibly damaging Het
Aspm C T 1: 139,397,131 (GRCm39) L908F probably damaging Het
Atp8b2 T A 3: 89,853,287 (GRCm39) T743S probably benign Het
Bag2 G T 1: 33,786,022 (GRCm39) T100K probably damaging Het
Camk2a A G 18: 61,076,246 (GRCm39) probably benign Het
Ccdc158 A G 5: 92,781,262 (GRCm39) Y848H probably damaging Het
Ccp110 T G 7: 118,324,653 (GRCm39) V725G possibly damaging Het
Cdh6 A G 15: 13,051,418 (GRCm39) V405A probably benign Het
Ces2g T C 8: 105,694,094 (GRCm39) probably null Het
Cfap157 A G 2: 32,667,554 (GRCm39) F510L probably benign Het
Chd3 A T 11: 69,250,722 (GRCm39) M669K possibly damaging Het
Cnot10 C T 9: 114,456,532 (GRCm39) A168T probably damaging Het
Crybg1 A G 10: 43,868,565 (GRCm39) V1371A probably damaging Het
Dars2 A G 1: 160,872,560 (GRCm39) L547P probably damaging Het
Dis3 A G 14: 99,325,226 (GRCm39) C483R probably damaging Het
Dnah7b T A 1: 46,395,762 (GRCm39) L3888Q probably damaging Het
Dpysl2 A T 14: 67,066,888 (GRCm39) Y182N probably damaging Het
Eif4g1 T A 16: 20,500,923 (GRCm39) F509L probably benign Het
Evc T C 5: 37,458,253 (GRCm39) T85A probably damaging Het
Farsb T C 1: 78,444,609 (GRCm39) T283A probably benign Het
Fem1al G T 11: 29,775,178 (GRCm39) A93E probably damaging Het
Fgf14 C A 14: 124,429,845 (GRCm39) R30L possibly damaging Het
Gbe1 T C 16: 70,275,289 (GRCm39) L363P probably damaging Het
Gcg A G 2: 62,307,189 (GRCm39) V124A probably damaging Het
Glb1l A G 1: 75,176,963 (GRCm39) probably benign Het
Gm5431 T C 11: 48,780,409 (GRCm39) E449G probably damaging Het
Gon4l T C 3: 88,802,655 (GRCm39) S1089P probably benign Het
Hgd T C 16: 37,409,111 (GRCm39) L25P probably damaging Het
Hnf1a T C 5: 115,093,311 (GRCm39) H318R possibly damaging Het
Hsd17b7 A C 1: 169,794,826 (GRCm39) V71G possibly damaging Het
Hydin T C 8: 111,233,126 (GRCm39) S1742P possibly damaging Het
Insyn2b A G 11: 34,353,154 (GRCm39) S399G probably benign Het
Kank2 T C 9: 21,691,078 (GRCm39) E552G probably benign Het
Kcnq4 C A 4: 120,573,810 (GRCm39) R217L probably damaging Het
Klrg2 T C 6: 38,604,540 (GRCm39) *201W probably null Het
Kndc1 T C 7: 139,501,821 (GRCm39) S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Lonp1 A G 17: 56,933,587 (GRCm39) V96A probably benign Het
Mgat4e T C 1: 134,469,478 (GRCm39) K189E possibly damaging Het
Msantd5f8 A G 4: 73,805,457 (GRCm39) S351P probably damaging Het
Msh2 G A 17: 88,026,187 (GRCm39) V722I possibly damaging Het
Mtcl3 A C 10: 29,026,390 (GRCm39) M491L probably benign Het
N4bp2 T C 5: 65,982,641 (GRCm39) Y1632H probably damaging Het
Nlrc4 T G 17: 74,743,032 (GRCm39) K862T probably damaging Het
Notch4 A T 17: 34,806,154 (GRCm39) Q1750L probably damaging Het
Obscn C T 11: 58,972,849 (GRCm39) V2066I possibly damaging Het
Or2v2 T C 11: 49,003,993 (GRCm39) K187E probably damaging Het
Or4c15 T A 2: 88,760,627 (GRCm39) I11L probably benign Het
Or4f14b A T 2: 111,775,156 (GRCm39) I215N probably damaging Het
Or52d13 A T 7: 103,110,243 (GRCm39) Y57* probably null Het
Or5m8 T C 2: 85,823,075 (GRCm39) S305P probably damaging Het
Pde7a T A 3: 19,295,655 (GRCm39) probably benign Het
Pign A T 1: 105,575,892 (GRCm39) Y249* probably null Het
Ppp1r17 A T 6: 56,003,449 (GRCm39) E87D probably damaging Het
Prss3 T A 6: 41,350,857 (GRCm39) Q211L probably damaging Het
Rapgef6 A G 11: 54,526,989 (GRCm39) E413G probably benign Het
Rnf150 A G 8: 83,590,712 (GRCm39) H25R probably damaging Het
Scamp2 T C 9: 57,488,934 (GRCm39) probably null Het
Scap T A 9: 110,203,410 (GRCm39) probably benign Het
Sdc2 A C 15: 33,032,602 (GRCm39) K175N probably damaging Het
Serpinb6d T A 13: 33,851,547 (GRCm39) probably null Het
Sh3tc2 A G 18: 62,146,164 (GRCm39) N1181S probably benign Het
Slc44a2 T C 9: 21,259,441 (GRCm39) I46T probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Spata1 C G 3: 146,175,529 (GRCm39) D326H probably damaging Het
Tbck T G 3: 132,507,288 (GRCm39) S753R probably benign Het
Tdp1 A G 12: 99,876,070 (GRCm39) I340M probably benign Het
Tmprss6 T A 15: 78,330,877 (GRCm39) Y50F probably damaging Het
Trank1 T A 9: 111,194,078 (GRCm39) S701T probably benign Het
Trbv17 A T 6: 41,140,223 (GRCm39) N26I probably benign Het
Trip12 A T 1: 84,771,531 (GRCm39) S248T probably damaging Het
Vmn2r53 T G 7: 12,335,330 (GRCm39) Q110P probably damaging Het
Vmn2r75 A G 7: 85,797,611 (GRCm39) V734A probably benign Het
Wfdc11 A T 2: 164,507,415 (GRCm39) M14K probably null Het
Xcr1 T A 9: 123,685,712 (GRCm39) M17L probably benign Het
Zbtb40 A G 4: 136,716,070 (GRCm39) I965T probably damaging Het
Zfp760 A T 17: 21,942,511 (GRCm39) H562L probably damaging Het
Zfp760 A T 17: 21,942,516 (GRCm39) R564* probably null Het
Znf41-ps T A 4: 145,555,283 (GRCm39) noncoding transcript Het
Zyg11a A T 4: 108,067,387 (GRCm39) I41N probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 82,894,169 (GRCm39) nonsense probably null
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2005:Slfn8 UTSW 11 82,894,976 (GRCm39) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 82,894,968 (GRCm39) missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 82,907,639 (GRCm39) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 82,894,422 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACAGGATGCTCACTCTTGTTAG -3'
(R):5'- TGATTGCCCCTTCAAAACAGTTTC -3'

Sequencing Primer
(F):5'- TGCATAGCAATTAATCCTCCTCCAG -3'
(R):5'- TGCCCCTTCAAAACAGTTTCTAAAG -3'
Posted On 2016-03-01