Mutagenetix > Incidental Mutations

Incidental Mutation 'R0239:Ptk2'

37235

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

038477-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0239 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

splice site (2 bp from exon)

DNA Base Change (assembly)

A to T at 73343283 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226466] [ENSMUST00000226791] [ENSMUST00000226848] [ENSMUST00000226893] [ENSMUST00000226988] [ENSMUST00000228180]

Predicted Effect

probably benign
Transcript: ENSMUST00000110036
AA Change: S15R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: S15R

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170939
AA Change: S15R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: S15R

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	287	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226466
AA Change: S15R

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226742

Predicted Effect

probably benign
Transcript: ENSMUST00000226791

Predicted Effect

probably null
Transcript: ENSMUST00000226848

Predicted Effect

probably null
Transcript: ENSMUST00000226893

Predicted Effect

probably benign
Transcript: ENSMUST00000226988
AA Change: S15R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227569

Predicted Effect

probably benign
Transcript: ENSMUST00000228180
AA Change: S15R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228628

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.9%

Validation Efficiency

100% (3/3)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	TTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCC	3: 138,065,834		probably benign	Het
Adra1d	C	A	2: 131,546,214	V474F	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Ash1l	A	G	3: 89,067,222	D2618G	possibly damaging	Het
Atp6v1c2	C	A	12: 17,294,675		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Camta1	A	G	4: 151,143,730	W882R	probably damaging	Het
Cd72	A	G	4: 43,453,163	V91A	probably benign	Het
Cdh12	T	C	15: 21,586,407	W771R	probably damaging	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,878	Y150C	probably damaging	Het
Depdc5	T	C	5: 32,943,240	S832P	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Espnl	T	C	1: 91,322,287	V52A	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gemin6	C	A	17: 80,225,710	A24D	probably damaging	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm9733	A	G	3: 15,296,601	L163P	probably damaging	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hyal5	T	A	6: 24,876,344	L72Q	probably damaging	Het
Ift140	C	A	17: 25,045,523	C557*	probably null	Het
Ikbkap	C	A	4: 56,784,596	V466L	probably benign	Het
Kbtbd3	G	T	9: 4,330,144	V173L	possibly damaging	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nacc2	T	G	2: 26,062,261	N361T	probably damaging	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nipal4	A	G	11: 46,150,441	V309A	possibly damaging	Het
Nomo1	T	C	7: 46,079,594		probably null	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Nwd2	A	T	5: 63,800,124	I266F	probably benign	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pah	C	T	10: 87,567,281	P173S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plekha4	A	G	7: 45,532,358	H62R	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Raet1e	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Scai	T	A	2: 39,075,042	I597F	probably benign	Het
Slc35c2	C	T	2: 165,280,837	G176S	probably damaging	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Tbc1d31	C	A	15: 57,940,753	T388N	probably benign	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tmem79	A	G	3: 88,333,321	S107P	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Tsnaxip1	T	A	8: 105,844,488	I660N	possibly damaging	Het
Ube2q2	T	C	9: 55,163,007	S78P	probably damaging	Het
Vac14	A	T	8: 110,635,375		probably null	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp532	A	T	18: 65,682,985	I810F	possibly damaging	Het
Zfp599	C	T	9: 22,249,759	C370Y	probably damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGACATCAGTAGCATCTCCATGCC -3'
(R):5'- AGTTTGCTCTTGCAGTGATACAGTCC -3'

Sequencing Primer
(F):5'- CTGATAATACTGGCCCAGGTG -3'
(R):5'- TGCAGTGATACAGTCCTACAAG -3'

Posted On

2013-05-09