Incidental Mutation 'R4859:Adam6a'
ID372350
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission 042470-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4859 (G1)
Quality Score140
Status Validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113545989 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 661 (N661D)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect probably damaging
Transcript: ENSMUST00000053086
AA Change: N661D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: N661D

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Tmprss6 T A 15: 78,446,677 Y50F probably damaging Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCATCAATCGGTTATCTCTGGG -3'
(R):5'- GCAATGCCAAAGAGCAGTGC -3'

Sequencing Primer
(F):5'- CATCAATCGGTTATCTCTGGGGTTAC -3'
(R):5'- TGCCAAAGAGCAGTGCAACAAAG -3'
Posted On2016-03-01