Incidental Mutation 'R4859:Tmprss6'
ID 372357
Institutional Source Beutler Lab
Gene Symbol Tmprss6
Ensembl Gene ENSMUSG00000016942
Gene Name transmembrane serine protease 6
Synonyms matriptase-2, 1300008A22Rik
MMRRC Submission 042470-MU
Accession Numbers

ENSMUST00000017086; MGI: 1919003

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4859 (G1)
Quality Score 109
Status Validated
Chromosome 15
Chromosomal Location 78439667-78468634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78446677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 50 (Y50F)
Ref Sequence ENSEMBL: ENSMUSP00000155414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017086] [ENSMUST00000229124] [ENSMUST00000229516] [ENSMUST00000230020] [ENSMUST00000230159] [ENSMUST00000230226]
AlphaFold Q9DBI0
Predicted Effect probably benign
Transcript: ENSMUST00000017086
AA Change: Y452F

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000017086
Gene: ENSMUSG00000016942
AA Change: Y452F

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:SEA 88 191 3.2e-13 PFAM
CUB 341 452 3.82e-2 SMART
LDLa 457 489 1.33e-2 SMART
LDLa 490 527 2.31e-9 SMART
LDLa 530 568 1.07e-4 SMART
Tryp_SPc 576 806 3.75e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229124
AA Change: Y50F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000229516
AA Change: Y452F

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230020
Predicted Effect probably damaging
Transcript: ENSMUST00000230159
AA Change: Y452F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230226
AA Change: Y440F

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230473
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane serine proteinase that is found attached to the cell surface. The encoded protein may be involved in matrix remodeling processes in the liver. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygosity for an inactivating mutation of this gene results in hair loss over the entire body except the face, microcytic anemia and female infertility, all reversible by dietary iron supplementation. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(6) Gene trapped(2) Chemically induced(3)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik G T 11: 29,825,178 A93E probably damaging Het
Adam25 T A 8: 40,754,543 V282E probably benign Het
Adam26b T C 8: 43,520,259 T569A possibly damaging Het
Adam6a A G 12: 113,545,989 N661D probably damaging Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adhfe1 A G 1: 9,558,213 Y270C probably damaging Het
Aldh16a1 C T 7: 45,147,307 R256H probably benign Het
Ap5z1 T C 5: 142,473,993 M466T possibly damaging Het
Aspm C T 1: 139,469,393 L908F probably damaging Het
Atp8b2 T A 3: 89,945,980 T743S probably benign Het
Bag2 G T 1: 33,746,941 T100K probably damaging Het
Camk2a A G 18: 60,943,174 probably benign Het
Ccdc158 A G 5: 92,633,403 Y848H probably damaging Het
Ccp110 T G 7: 118,725,430 V725G possibly damaging Het
Cdh6 A G 15: 13,051,332 V405A probably benign Het
Ces2g T C 8: 104,967,462 probably null Het
Cfap157 A G 2: 32,777,542 F510L probably benign Het
Chd3 A T 11: 69,359,896 M669K possibly damaging Het
Cnot10 C T 9: 114,627,464 A168T probably damaging Het
Crybg1 A G 10: 43,992,569 V1371A probably damaging Het
Dars2 A G 1: 161,044,990 L547P probably damaging Het
Dis3 A G 14: 99,087,790 C483R probably damaging Het
Dnah7b T A 1: 46,356,602 L3888Q probably damaging Het
Dpysl2 A T 14: 66,829,439 Y182N probably damaging Het
Eif4g1 T A 16: 20,682,173 F509L probably benign Het
Evc T C 5: 37,300,909 T85A probably damaging Het
Fam196b A G 11: 34,403,154 S399G probably benign Het
Farsb T C 1: 78,467,972 T283A probably benign Het
Fgf14 C A 14: 124,192,433 R30L possibly damaging Het
Gbe1 T C 16: 70,478,401 L363P probably damaging Het
Gcg A G 2: 62,476,845 V124A probably damaging Het
Glb1l A G 1: 75,200,319 probably benign Het
Gm11757 A G 4: 73,887,220 S351P probably damaging Het
Gm5431 T C 11: 48,889,582 E449G probably damaging Het
Gon4l T C 3: 88,895,348 S1089P probably benign Het
Hgd T C 16: 37,588,749 L25P probably damaging Het
Hnf1a T C 5: 114,955,252 H318R possibly damaging Het
Hsd17b7 A C 1: 169,967,257 V71G possibly damaging Het
Hydin T C 8: 110,506,494 S1742P possibly damaging Het
Kank2 T C 9: 21,779,782 E552G probably benign Het
Kcnq4 C A 4: 120,716,613 R217L probably damaging Het
Klrg2 T C 6: 38,627,605 *201W probably null Het
Kndc1 T C 7: 139,921,905 S953P probably benign Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Lonp1 A G 17: 56,626,587 V96A probably benign Het
Mgat4e T C 1: 134,541,740 K189E possibly damaging Het
Msh2 G A 17: 87,718,759 V722I possibly damaging Het
N4bp2 T C 5: 65,825,298 Y1632H probably damaging Het
Nlrc4 T G 17: 74,436,037 K862T probably damaging Het
Notch4 A T 17: 34,587,180 Q1750L probably damaging Het
Obscn C T 11: 59,082,023 V2066I possibly damaging Het
Olfr1031 T C 2: 85,992,731 S305P probably damaging Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr1307 A T 2: 111,944,811 I215N probably damaging Het
Olfr1396 T C 11: 49,113,166 K187E probably damaging Het
Olfr607 A T 7: 103,461,036 Y57* probably null Het
Pde7a T A 3: 19,241,491 probably benign Het
Pign A T 1: 105,648,167 Y249* probably null Het
Ppp1r17 A T 6: 56,026,464 E87D probably damaging Het
Prss3 T A 6: 41,373,923 Q211L probably damaging Het
Rapgef6 A G 11: 54,636,163 E413G probably benign Het
Rnf150 A G 8: 82,864,083 H25R probably damaging Het
Scamp2 T C 9: 57,581,651 probably null Het
Scap T A 9: 110,374,342 probably benign Het
Sdc2 A C 15: 33,032,456 K175N probably damaging Het
Serpinb6d T A 13: 33,667,564 probably null Het
Sh3tc2 A G 18: 62,013,093 N1181S probably benign Het
Slc44a2 T C 9: 21,348,145 I46T probably damaging Het
Slfn8 A G 11: 83,017,714 M1T probably null Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Soga3 A C 10: 29,150,394 M491L probably benign Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
Tbck T G 3: 132,801,527 S753R probably benign Het
Tdp1 A G 12: 99,909,811 I340M probably benign Het
Trank1 T A 9: 111,365,010 S701T probably benign Het
Trbv17 A T 6: 41,163,289 N26I probably benign Het
Trip12 A T 1: 84,793,810 S248T probably damaging Het
Vmn2r53 T G 7: 12,601,403 Q110P probably damaging Het
Vmn2r75 A G 7: 86,148,403 V734A probably benign Het
Wfdc11 A T 2: 164,665,495 M14K probably null Het
Xcr1 T A 9: 123,856,647 M17L probably benign Het
Zbtb40 A G 4: 136,988,759 I965T probably damaging Het
Zfp760 A T 17: 21,723,530 H562L probably damaging Het
Zfp760 A T 17: 21,723,535 R564* probably null Het
Znf41-ps T A 4: 145,828,713 noncoding transcript Het
Zyg11a A T 4: 108,210,190 I41N probably damaging Het
Other mutations in Tmprss6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tmprss6 APN 15 78442434 missense probably null 1.00
IGL02474:Tmprss6 APN 15 78442336 missense probably damaging 0.99
cubone UTSW 15 78446657 splice site probably null
dilutional UTSW 15 78444128 missense probably damaging 1.00
Ekans UTSW 15 78459427 splice site probably null
mask UTSW 15 78464455 intron probably benign
masquerade UTSW 15 78468000 intron probably benign
zorro UTSW 15 78464552 intron probably benign
BB003:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
BB013:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
PIT1430001:Tmprss6 UTSW 15 78440627 missense probably damaging 1.00
R0285:Tmprss6 UTSW 15 78452868 missense probably damaging 0.99
R1857:Tmprss6 UTSW 15 78452552 missense probably damaging 1.00
R2432:Tmprss6 UTSW 15 78465104 splice site probably benign
R4192:Tmprss6 UTSW 15 78446657 splice site probably null
R4226:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4227:Tmprss6 UTSW 15 78446699 missense probably damaging 1.00
R4334:Tmprss6 UTSW 15 78459427 splice site probably null
R4344:Tmprss6 UTSW 15 78459427 splice site probably null
R4446:Tmprss6 UTSW 15 78452839 missense probably damaging 1.00
R4508:Tmprss6 UTSW 15 78459778 missense probably damaging 1.00
R4643:Tmprss6 UTSW 15 78445356 missense probably damaging 0.98
R4743:Tmprss6 UTSW 15 78443710 missense probably damaging 0.99
R4836:Tmprss6 UTSW 15 78445388 missense probably damaging 1.00
R4869:Tmprss6 UTSW 15 78443680 splice site probably null
R5197:Tmprss6 UTSW 15 78454189 missense probably damaging 1.00
R5212:Tmprss6 UTSW 15 78446260 missense probably damaging 0.99
R5225:Tmprss6 UTSW 15 78452507 missense probably damaging 0.97
R5569:Tmprss6 UTSW 15 78440303 missense probably damaging 1.00
R5572:Tmprss6 UTSW 15 78442422 missense probably damaging 1.00
R5669:Tmprss6 UTSW 15 78454956 missense possibly damaging 0.86
R5947:Tmprss6 UTSW 15 78452522 missense probably damaging 1.00
R6800:Tmprss6 UTSW 15 78440257 missense probably damaging 1.00
R6941:Tmprss6 UTSW 15 78446777 missense probably damaging 1.00
R6965:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R7334:Tmprss6 UTSW 15 78443817 missense unknown
R7338:Tmprss6 UTSW 15 78459819 missense probably damaging 1.00
R7622:Tmprss6 UTSW 15 78446726 missense probably benign 0.40
R7926:Tmprss6 UTSW 15 78452850 missense probably benign 0.28
R7992:Tmprss6 UTSW 15 78442464 missense probably benign 0.11
R8177:Tmprss6 UTSW 15 78465127 missense probably benign 0.01
R8792:Tmprss6 UTSW 15 78444128 missense probably damaging 1.00
R8881:Tmprss6 UTSW 15 78443787 makesense probably null
R9084:Tmprss6 UTSW 15 78454217 missense probably damaging 0.98
R9384:Tmprss6 UTSW 15 78444102 missense probably damaging 0.99
X0025:Tmprss6 UTSW 15 78455095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACATGTGACTGCCTACCCAG -3'
(R):5'- TGCATAGGAACCTAGGTTGTTTC -3'

Sequencing Primer
(F):5'- TACCCAGCACATAAAACTACGTG -3'
(R):5'- ATATGCTGAGAGGATCCC -3'
Posted On 2016-03-01