Mutagenetix > Incidental Mutation

Incidental Mutation 'R4859:Lonp1'

372367

Institutional Source

Beutler Lab

Gene Symbol

Lonp1

Ensembl Gene

ENSMUSG00000041168

Gene Name

lon peptidase 1, mitochondrial

Synonyms

1200017E13Rik, LON, Prss15

MMRRC Submission

042470-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4859 (G1)

Quality Score

184

Status

Not validated

Chromosome

Chromosomal Location

56614301-56626903 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56626587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 96 (V96A)

Ref Sequence

ENSEMBL: ENSMUSP00000041814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047226] [ENSMUST00000112979]

AlphaFold

Q8CGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000047226
AA Change: V96A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000041814
Gene: ENSMUSG00000041168
AA Change: V96A

Domain	Start	End	E-Value	Type
LON	111	357	3.95e-62	SMART
low complexity region	389	404	N/A	INTRINSIC
AAA	504	649	1.81e-14	SMART
Pfam:Lon_C	725	938	1e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112979

SMART Domains

Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:CATSPERD	38	766	N/A	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.5%

Validation Efficiency

100% (112/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality with embryonic growth retardation, small size and decreased mitochondrial DNA content. Mice heterozygous for this allele exhibit reduced chemically-induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	G	T	11: 29,825,178	A93E	probably damaging	Het
Adam25	T	A	8: 40,754,543	V282E	probably benign	Het
Adam26b	T	C	8: 43,520,259	T569A	possibly damaging	Het
Adam6a	A	G	12: 113,545,989	N661D	probably damaging	Het
Adck1	G	A	12: 88,441,095	A199T	probably benign	Het
Adhfe1	A	G	1: 9,558,213	Y270C	probably damaging	Het
Aldh16a1	C	T	7: 45,147,307	R256H	probably benign	Het
Ap5z1	T	C	5: 142,473,993	M466T	possibly damaging	Het
Aspm	C	T	1: 139,469,393	L908F	probably damaging	Het
Atp8b2	T	A	3: 89,945,980	T743S	probably benign	Het
Bag2	G	T	1: 33,746,941	T100K	probably damaging	Het
Camk2a	A	G	18: 60,943,174		probably benign	Het
Ccdc158	A	G	5: 92,633,403	Y848H	probably damaging	Het
Ccp110	T	G	7: 118,725,430	V725G	possibly damaging	Het
Cdh6	A	G	15: 13,051,332	V405A	probably benign	Het
Ces2g	T	C	8: 104,967,462		probably null	Het
Cfap157	A	G	2: 32,777,542	F510L	probably benign	Het
Chd3	A	T	11: 69,359,896	M669K	possibly damaging	Het
Cnot10	C	T	9: 114,627,464	A168T	probably damaging	Het
Crybg1	A	G	10: 43,992,569	V1371A	probably damaging	Het
Dars2	A	G	1: 161,044,990	L547P	probably damaging	Het
Dis3	A	G	14: 99,087,790	C483R	probably damaging	Het
Dnah7b	T	A	1: 46,356,602	L3888Q	probably damaging	Het
Dpysl2	A	T	14: 66,829,439	Y182N	probably damaging	Het
Eif4g1	T	A	16: 20,682,173	F509L	probably benign	Het
Evc	T	C	5: 37,300,909	T85A	probably damaging	Het
Fam196b	A	G	11: 34,403,154	S399G	probably benign	Het
Farsb	T	C	1: 78,467,972	T283A	probably benign	Het
Fgf14	C	A	14: 124,192,433	R30L	possibly damaging	Het
Gbe1	T	C	16: 70,478,401	L363P	probably damaging	Het
Gcg	A	G	2: 62,476,845	V124A	probably damaging	Het
Glb1l	A	G	1: 75,200,319		probably benign	Het
Gm11757	A	G	4: 73,887,220	S351P	probably damaging	Het
Gm5431	T	C	11: 48,889,582	E449G	probably damaging	Het
Gon4l	T	C	3: 88,895,348	S1089P	probably benign	Het
Hgd	T	C	16: 37,588,749	L25P	probably damaging	Het
Hnf1a	T	C	5: 114,955,252	H318R	possibly damaging	Het
Hsd17b7	A	C	1: 169,967,257	V71G	possibly damaging	Het
Hydin	T	C	8: 110,506,494	S1742P	possibly damaging	Het
Kank2	T	C	9: 21,779,782	E552G	probably benign	Het
Kcnq4	C	A	4: 120,716,613	R217L	probably damaging	Het
Klrg2	T	C	6: 38,627,605	*201W	probably null	Het
Kndc1	T	C	7: 139,921,905	S953P	probably benign	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Mgat4e	T	C	1: 134,541,740	K189E	possibly damaging	Het
Msh2	G	A	17: 87,718,759	V722I	possibly damaging	Het
N4bp2	T	C	5: 65,825,298	Y1632H	probably damaging	Het
Nlrc4	T	G	17: 74,436,037	K862T	probably damaging	Het
Notch4	A	T	17: 34,587,180	Q1750L	probably damaging	Het
Obscn	C	T	11: 59,082,023	V2066I	possibly damaging	Het
Olfr1031	T	C	2: 85,992,731	S305P	probably damaging	Het
Olfr1211	T	A	2: 88,930,283	I11L	probably benign	Het
Olfr1307	A	T	2: 111,944,811	I215N	probably damaging	Het
Olfr1396	T	C	11: 49,113,166	K187E	probably damaging	Het
Olfr607	A	T	7: 103,461,036	Y57*	probably null	Het
Pde7a	T	A	3: 19,241,491		probably benign	Het
Pign	A	T	1: 105,648,167	Y249*	probably null	Het
Ppp1r17	A	T	6: 56,026,464	E87D	probably damaging	Het
Prss3	T	A	6: 41,373,923	Q211L	probably damaging	Het
Rapgef6	A	G	11: 54,636,163	E413G	probably benign	Het
Rnf150	A	G	8: 82,864,083	H25R	probably damaging	Het
Scamp2	T	C	9: 57,581,651		probably null	Het
Scap	T	A	9: 110,374,342		probably benign	Het
Sdc2	A	C	15: 33,032,456	K175N	probably damaging	Het
Serpinb6d	T	A	13: 33,667,564		probably null	Het
Sh3tc2	A	G	18: 62,013,093	N1181S	probably benign	Het
Slc44a2	T	C	9: 21,348,145	I46T	probably damaging	Het
Slfn8	A	G	11: 83,017,714	M1T	probably null	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Soga3	A	C	10: 29,150,394	M491L	probably benign	Het
Spata1	C	G	3: 146,469,774	D326H	probably damaging	Het
Tbck	T	G	3: 132,801,527	S753R	probably benign	Het
Tdp1	A	G	12: 99,909,811	I340M	probably benign	Het
Tmprss6	T	A	15: 78,446,677	Y50F	probably damaging	Het
Trank1	T	A	9: 111,365,010	S701T	probably benign	Het
Trbv17	A	T	6: 41,163,289	N26I	probably benign	Het
Trip12	A	T	1: 84,793,810	S248T	probably damaging	Het
Vmn2r53	T	G	7: 12,601,403	Q110P	probably damaging	Het
Vmn2r75	A	G	7: 86,148,403	V734A	probably benign	Het
Wfdc11	A	T	2: 164,665,495	M14K	probably null	Het
Xcr1	T	A	9: 123,856,647	M17L	probably benign	Het
Zbtb40	A	G	4: 136,988,759	I965T	probably damaging	Het
Zfp760	A	T	17: 21,723,530	H562L	probably damaging	Het
Zfp760	A	T	17: 21,723,535	R564*	probably null	Het
Znf41-ps	T	A	4: 145,828,713		noncoding transcript	Het
Zyg11a	A	T	4: 108,210,190	I41N	probably damaging	Het

Other mutations in Lonp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Lonp1	APN	17	56619265	missense	probably damaging	1.00
IGL00934:Lonp1	APN	17	56614683	missense	probably benign	0.21
IGL01065:Lonp1	APN	17	56615500	unclassified	probably benign
IGL01343:Lonp1	APN	17	56615586	missense	possibly damaging	0.93
IGL01734:Lonp1	APN	17	56616026	missense	probably damaging	1.00
IGL02141:Lonp1	APN	17	56615086	missense	probably benign	0.19
IGL02979:Lonp1	APN	17	56621940	missense	probably benign	0.02
chaney	UTSW	17	56622515	missense	probably damaging	1.00
Karloff	UTSW	17	56618406	missense	probably benign
R0015:Lonp1	UTSW	17	56618406	missense	probably benign
R0015:Lonp1	UTSW	17	56618406	missense	probably benign
R0863:Lonp1	UTSW	17	56618331	missense	probably damaging	1.00
R1343:Lonp1	UTSW	17	56620272	missense	probably damaging	1.00
R1735:Lonp1	UTSW	17	56614956	missense	probably damaging	1.00
R1975:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R1976:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R1977:Lonp1	UTSW	17	56615068	missense	possibly damaging	0.69
R2484:Lonp1	UTSW	17	56614659	missense	probably damaging	1.00
R2895:Lonp1	UTSW	17	56615562	missense	probably damaging	1.00
R3123:Lonp1	UTSW	17	56626488	missense	possibly damaging	0.79
R3125:Lonp1	UTSW	17	56626488	missense	possibly damaging	0.79
R3429:Lonp1	UTSW	17	56618337	missense	probably damaging	1.00
R3726:Lonp1	UTSW	17	56618310	unclassified	probably benign
R3767:Lonp1	UTSW	17	56621952	missense	possibly damaging	0.80
R4618:Lonp1	UTSW	17	56622511	missense	probably benign	0.03
R4951:Lonp1	UTSW	17	56620335	missense	possibly damaging	0.64
R5208:Lonp1	UTSW	17	56617793	missense	probably damaging	1.00
R5620:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R5621:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R5622:Lonp1	UTSW	17	56620263	missense	probably benign	0.05
R6131:Lonp1	UTSW	17	56614457	missense	probably benign	0.01
R6377:Lonp1	UTSW	17	56621961	missense	possibly damaging	0.90
R6692:Lonp1	UTSW	17	56619230	missense	probably damaging	1.00
R7052:Lonp1	UTSW	17	56626549	missense	probably benign	0.31
R7131:Lonp1	UTSW	17	56617814	missense	probably damaging	1.00
R7295:Lonp1	UTSW	17	56622495	missense	possibly damaging	0.70
R7739:Lonp1	UTSW	17	56626620	missense	probably benign
R7792:Lonp1	UTSW	17	56622515	missense	probably damaging	1.00
R8307:Lonp1	UTSW	17	56626573	missense	probably benign	0.01
R8546:Lonp1	UTSW	17	56626702	missense	probably benign	0.00
R9257:Lonp1	UTSW	17	56620516	nonsense	probably null
R9586:Lonp1	UTSW	17	56617839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCTTAGACGCGAGGGAGC -3'
(R):5'- AGAACATCCTTCATCGGGCC -3'

Sequencing Primer
(F):5'- AGCTGAGAGACCACTCGG -3'
(R):5'- TCTGAGCCTTGAACCACGC -3'

Posted On

2016-03-01