Mutagenetix > Incidental Mutation

Incidental Mutation 'R0239:Ift140'

37237

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

038477-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0239 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 25045523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 557 (C557*)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably null
Transcript: ENSMUST00000024983
AA Change: C557*

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: C557*

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386
AA Change: C557*

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: C557*

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.9%

Validation Efficiency

100% (3/3)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	TTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCC	3: 138,065,834		probably benign	Het
Adra1d	C	A	2: 131,546,214	V474F	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Ash1l	A	G	3: 89,067,222	D2618G	possibly damaging	Het
Atp6v1c2	C	A	12: 17,294,675		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Camta1	A	G	4: 151,143,730	W882R	probably damaging	Het
Cd72	A	G	4: 43,453,163	V91A	probably benign	Het
Cdh12	T	C	15: 21,586,407	W771R	probably damaging	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
D3Ertd751e	A	G	3: 41,753,878	Y150C	probably damaging	Het
Depdc5	T	C	5: 32,943,240	S832P	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Espnl	T	C	1: 91,322,287	V52A	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gemin6	C	A	17: 80,225,710	A24D	probably damaging	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm9733	A	G	3: 15,296,601	L163P	probably damaging	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hyal5	T	A	6: 24,876,344	L72Q	probably damaging	Het
Ikbkap	C	A	4: 56,784,596	V466L	probably benign	Het
Kbtbd3	G	T	9: 4,330,144	V173L	possibly damaging	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nacc2	T	G	2: 26,062,261	N361T	probably damaging	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nipal4	A	G	11: 46,150,441	V309A	possibly damaging	Het
Nomo1	T	C	7: 46,079,594		probably null	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Nwd2	A	T	5: 63,800,124	I266F	probably benign	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pah	C	T	10: 87,567,281	P173S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plekha4	A	G	7: 45,532,358	H62R	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Ptk2	A	T	15: 73,343,283		probably null	Het
Raet1e	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Scai	T	A	2: 39,075,042	I597F	probably benign	Het
Slc35c2	C	T	2: 165,280,837	G176S	probably damaging	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Tbc1d31	C	A	15: 57,940,753	T388N	probably benign	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tmem79	A	G	3: 88,333,321	S107P	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Tsnaxip1	T	A	8: 105,844,488	I660N	possibly damaging	Het
Ube2q2	T	C	9: 55,163,007	S78P	probably damaging	Het
Vac14	A	T	8: 110,635,375		probably null	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp532	A	T	18: 65,682,985	I810F	possibly damaging	Het
Zfp599	C	T	9: 22,249,759	C370Y	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03
R9782:Ift140	UTSW	17	25045177	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGGACTGTCAAACAACTTCTGC -3'
(R):5'- ACAGCTATGTCTGTCAGGTCCTGC -3'

Sequencing Primer
(F):5'- AGAAGGTACAGTTTCCTTCCAC -3'
(R):5'- TGCTAAGGAGGATGCTGATC -3'

Posted On

2013-05-09