Incidental Mutation 'R4860:Ddx58'
ID372385
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission 042471-MU
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40210000 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 644 (S644R)
Ref Sequence ENSEMBL: ENSMUSP00000115052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037907
AA Change: S689R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: S689R

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140616
Predicted Effect probably damaging
Transcript: ENSMUST00000142055
AA Change: S644R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296
AA Change: S644R

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7729:Ddx58 UTSW 4 40206034 missense possibly damaging 0.53
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
R7965:Ddx58 UTSW 4 40223824 nonsense probably null
R7976:Ddx58 UTSW 4 40209894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTACCAGAGTCAGCTGTG -3'
(R):5'- TTAACGAGAATGGTGAAACCTGAGC -3'

Sequencing Primer
(F):5'- AGCTGTGCTGTCAATCACATG -3'
(R):5'- GTGAGTTGTACAGTGACCTC -3'
Posted On2016-03-01