Incidental Mutation 'R4860:Macf1'
ID 372391
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Name microtubule-actin crosslinking factor 1
Synonyms trabeculin alpha, Aclp7, Acf7
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 123243426-123581331 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123380543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1263 (Y1263N)
Ref Sequence ENSEMBL: ENSMUSP00000114568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000134458] [ENSMUST00000147030] [ENSMUST00000151346] [ENSMUST00000147228]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082108
AA Change: Y1357N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649
AA Change: Y1357N

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084301
AA Change: Y1357N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: Y1357N

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097897
AA Change: Y1357N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: Y1357N

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106220
AA Change: Y1508N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649
AA Change: Y1508N

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 5e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 1.85e-1 SMART
SPEC 1968 2078 4.03e-9 SMART
SPEC 2085 2191 1.75e-9 SMART
SPEC 2198 2300 5.57e-3 SMART
SPEC 2307 2406 4.56e0 SMART
SPEC 2413 2544 3.46e-1 SMART
SPEC 2551 2656 1.29e-7 SMART
SPEC 2663 2767 1.19e-2 SMART
SPEC 2774 2877 2.7e-1 SMART
SPEC 2884 2987 4.99e-14 SMART
SPEC 2994 3094 1.9e-5 SMART
SPEC 3101 3207 2.83e0 SMART
SPEC 3210 3312 2.14e-4 SMART
SPEC 3319 3423 3.01e-8 SMART
SPEC 3430 3532 4.48e-16 SMART
SPEC 3539 3641 1.26e-10 SMART
SPEC 3648 3750 2.26e-3 SMART
SPEC 3757 3859 4.29e-4 SMART
SPEC 3866 3967 9.99e-14 SMART
SPEC 3974 4080 5.79e-2 SMART
SPEC 4087 4189 6.59e-14 SMART
SPEC 4196 4299 3.7e-17 SMART
SPEC 4306 4408 1.16e-23 SMART
SPEC 4415 4518 3.58e-15 SMART
SPEC 4525 4627 2.61e-17 SMART
SPEC 4634 4737 9.38e-19 SMART
SPEC 4744 4845 2.29e-22 SMART
SPEC 4852 4954 4.99e-14 SMART
SPEC 4961 5091 1.45e-10 SMART
EFh 5129 5157 5.08e-3 SMART
EFh 5165 5193 1.17e-2 SMART
GAS2 5204 5282 1.59e-53 SMART
low complexity region 5304 5349 N/A INTRINSIC
low complexity region 5398 5423 N/A INTRINSIC
low complexity region 5440 5452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106224
AA Change: Y1357N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: Y1357N

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134458
AA Change: Y489N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119885
Gene: ENSMUSG00000028649
AA Change: Y489N

DomainStartEndE-ValueType
PDB:3R6N|B 3 168 5e-37 PDB
coiled coil region 178 199 N/A INTRINSIC
SPEC 410 539 2.35e0 SMART
SPEC 557 665 1.12e-7 SMART
SPEC 682 790 3.94e-3 SMART
SPEC 950 1060 4.03e-9 SMART
SPEC 1067 1173 1.75e-9 SMART
SPEC 1180 1282 5.57e-3 SMART
SPEC 1289 1388 4.56e0 SMART
SPEC 1395 1505 3.18e-1 SMART
SPEC 1512 1617 1.29e-7 SMART
SPEC 1624 1728 1.19e-2 SMART
SPEC 1735 1838 2.7e-1 SMART
SPEC 1845 1948 4.99e-14 SMART
SPEC 1955 2055 1.9e-5 SMART
SPEC 2062 2168 2.83e0 SMART
SPEC 2171 2273 2.14e-4 SMART
SPEC 2280 2384 3.01e-8 SMART
SPEC 2391 2493 4.48e-16 SMART
SPEC 2500 2602 1.26e-10 SMART
SPEC 2609 2711 2.26e-3 SMART
SPEC 2718 2820 4.29e-4 SMART
SPEC 2827 2928 9.99e-14 SMART
SPEC 2935 3041 5.79e-2 SMART
SPEC 3048 3150 6.59e-14 SMART
SPEC 3157 3260 3.7e-17 SMART
SPEC 3267 3369 1.16e-23 SMART
SPEC 3376 3479 3.58e-15 SMART
SPEC 3486 3588 2.61e-17 SMART
SPEC 3595 3698 9.38e-19 SMART
SPEC 3705 3806 2.29e-22 SMART
SPEC 3813 3915 4.99e-14 SMART
SPEC 3922 4052 1.45e-10 SMART
EFh 4086 4114 5.08e-3 SMART
EFh 4122 4150 1.17e-2 SMART
GAS2 4161 4233 2.28e-54 SMART
low complexity region 4255 4300 N/A INTRINSIC
low complexity region 4349 4374 N/A INTRINSIC
low complexity region 4391 4403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147030
AA Change: Y1315N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123246
Gene: ENSMUSG00000028649
AA Change: Y1315N

DomainStartEndE-ValueType
CH 38 137 5.63e-28 SMART
CH 154 251 7.49e-24 SMART
SPEC 275 378 4.11e0 SMART
SPEC 541 638 4.32e-9 SMART
SPEC 641 741 5.75e-5 SMART
Blast:SPEC 748 913 2e-82 BLAST
coiled coil region 1004 1025 N/A INTRINSIC
SPEC 1236 1365 2.35e0 SMART
SPEC 1383 1491 1.12e-7 SMART
SPEC 1508 1616 3.94e-3 SMART
Pfam:Spectrin 1773 1837 9.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151346
AA Change: Y1263N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649
AA Change: Y1263N

DomainStartEndE-ValueType
CH 4 85 4.88e-14 SMART
CH 102 199 7.49e-24 SMART
SPEC 223 326 4.11e0 SMART
SPEC 489 586 4.32e-9 SMART
SPEC 589 689 5.75e-5 SMART
Blast:SPEC 696 861 3e-82 BLAST
coiled coil region 952 973 N/A INTRINSIC
SPEC 1184 1313 2.35e0 SMART
SPEC 1331 1439 1.12e-7 SMART
SPEC 1456 1564 3.94e-3 SMART
SPEC 1724 1834 4.03e-9 SMART
SPEC 1841 1947 1.75e-9 SMART
SPEC 1954 2056 5.57e-3 SMART
SPEC 2063 2162 4.56e0 SMART
SPEC 2169 2300 3.46e-1 SMART
SPEC 2307 2412 1.29e-7 SMART
SPEC 2419 2523 1.19e-2 SMART
SPEC 2530 2633 2.7e-1 SMART
SPEC 2640 2743 4.99e-14 SMART
SPEC 2750 2850 1.9e-5 SMART
SPEC 2857 2963 2.83e0 SMART
SPEC 2966 3068 2.14e-4 SMART
SPEC 3075 3179 3.01e-8 SMART
SPEC 3186 3288 4.48e-16 SMART
SPEC 3295 3397 4.15e-11 SMART
SPEC 3404 3506 7.07e-5 SMART
SPEC 3513 3615 2.26e-3 SMART
SPEC 3622 3724 4.29e-4 SMART
SPEC 3731 3832 9.99e-14 SMART
SPEC 3839 3945 5.79e-2 SMART
SPEC 3952 4054 6.59e-14 SMART
SPEC 4061 4164 3.7e-17 SMART
SPEC 4171 4273 1.16e-23 SMART
SPEC 4280 4383 3.58e-15 SMART
SPEC 4390 4492 2.61e-17 SMART
SPEC 4499 4602 9.38e-19 SMART
SPEC 4609 4710 2.29e-22 SMART
SPEC 4717 4819 4.99e-14 SMART
SPEC 4826 4956 1.45e-10 SMART
EFh 4990 5018 5.08e-3 SMART
EFh 5026 5054 1.17e-2 SMART
GAS2 5065 5137 2.28e-54 SMART
low complexity region 5159 5204 N/A INTRINSIC
low complexity region 5253 5278 N/A INTRINSIC
low complexity region 5295 5307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147228
AA Change: Y1508N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115847
Gene: ENSMUSG00000028649
AA Change: Y1508N

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 4e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 3.94e-3 SMART
Pfam:Spectrin 1966 2030 6.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158963
Meta Mutation Damage Score 0.5065 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123,275,915 (GRCm39) missense probably damaging 0.99
IGL01293:Macf1 APN 4 123,365,104 (GRCm39) missense probably benign 0.00
IGL01307:Macf1 APN 4 123,276,922 (GRCm39) missense probably damaging 1.00
IGL01314:Macf1 APN 4 123,380,513 (GRCm39) missense probably damaging 1.00
IGL01321:Macf1 APN 4 123,334,567 (GRCm39) missense probably damaging 1.00
IGL01327:Macf1 APN 4 123,403,705 (GRCm39) missense probably benign 0.20
IGL01365:Macf1 APN 4 123,284,962 (GRCm39) missense probably damaging 1.00
IGL01465:Macf1 APN 4 123,384,514 (GRCm39) missense probably benign 0.00
IGL01527:Macf1 APN 4 123,386,953 (GRCm39) missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123,367,666 (GRCm39) missense probably damaging 1.00
IGL01539:Macf1 APN 4 123,289,701 (GRCm39) splice site probably benign
IGL01543:Macf1 APN 4 123,295,250 (GRCm39) missense probably damaging 1.00
IGL01553:Macf1 APN 4 123,386,956 (GRCm39) nonsense probably null
IGL01558:Macf1 APN 4 123,346,798 (GRCm39) missense probably benign 0.00
IGL01633:Macf1 APN 4 123,395,964 (GRCm39) missense probably damaging 0.99
IGL01684:Macf1 APN 4 123,359,723 (GRCm39) missense probably damaging 1.00
IGL01715:Macf1 APN 4 123,284,879 (GRCm39) missense probably damaging 1.00
IGL01844:Macf1 APN 4 123,334,485 (GRCm39) missense probably benign 0.34
IGL01870:Macf1 APN 4 123,367,906 (GRCm39) missense probably damaging 0.99
IGL01916:Macf1 APN 4 123,335,423 (GRCm39) missense probably damaging 1.00
IGL01916:Macf1 APN 4 123,369,830 (GRCm39) missense probably damaging 1.00
IGL01923:Macf1 APN 4 123,274,237 (GRCm39) missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123,393,724 (GRCm39) missense probably damaging 1.00
IGL02022:Macf1 APN 4 123,284,842 (GRCm39) critical splice donor site probably null
IGL02084:Macf1 APN 4 123,326,396 (GRCm39) missense probably benign 0.02
IGL02084:Macf1 APN 4 123,353,167 (GRCm39) missense probably damaging 1.00
IGL02142:Macf1 APN 4 123,365,842 (GRCm39) missense probably benign 0.11
IGL02151:Macf1 APN 4 123,265,559 (GRCm39) splice site probably benign
IGL02164:Macf1 APN 4 123,374,065 (GRCm39) missense probably benign 0.03
IGL02174:Macf1 APN 4 123,385,587 (GRCm39) missense probably damaging 1.00
IGL02229:Macf1 APN 4 123,403,619 (GRCm39) missense probably damaging 1.00
IGL02277:Macf1 APN 4 123,380,497 (GRCm39) missense probably damaging 1.00
IGL02283:Macf1 APN 4 123,365,168 (GRCm39) missense probably benign 0.01
IGL02314:Macf1 APN 4 123,338,630 (GRCm39) missense probably damaging 0.99
IGL02327:Macf1 APN 4 123,365,523 (GRCm39) missense probably benign 0.06
IGL02348:Macf1 APN 4 123,406,659 (GRCm39) missense probably damaging 1.00
IGL02441:Macf1 APN 4 123,281,029 (GRCm39) missense probably damaging 1.00
IGL02585:Macf1 APN 4 123,366,077 (GRCm39) missense probably benign 0.00
IGL02602:Macf1 APN 4 123,248,956 (GRCm39) missense probably damaging 1.00
IGL03204:Macf1 APN 4 123,249,070 (GRCm39) splice site probably benign
anakex UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
esfuerzo UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
Royal_flush UTSW 4 123,259,148 (GRCm39) splice site probably null
standard UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
suspension UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
voragine UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
BB010:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
BB020:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
H8562:Macf1 UTSW 4 123,359,833 (GRCm39) missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123,281,188 (GRCm39) missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123,367,114 (GRCm39) missense probably benign 0.43
R0021:Macf1 UTSW 4 123,369,370 (GRCm39) missense probably damaging 1.00
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0028:Macf1 UTSW 4 123,275,895 (GRCm39) missense probably damaging 1.00
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123,367,661 (GRCm39) missense probably damaging 1.00
R0106:Macf1 UTSW 4 123,302,357 (GRCm39) missense probably benign 0.00
R0123:Macf1 UTSW 4 123,326,636 (GRCm39) missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123,327,068 (GRCm39) missense probably damaging 1.00
R0134:Macf1 UTSW 4 123,326,636 (GRCm39) missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123,334,540 (GRCm39) missense probably damaging 1.00
R0145:Macf1 UTSW 4 123,281,190 (GRCm39) missense probably damaging 1.00
R0195:Macf1 UTSW 4 123,328,709 (GRCm39) missense probably damaging 0.99
R0227:Macf1 UTSW 4 123,293,184 (GRCm39) missense probably benign 0.14
R0233:Macf1 UTSW 4 123,343,920 (GRCm39) splice site probably benign
R0254:Macf1 UTSW 4 123,326,572 (GRCm39) missense probably damaging 1.00
R0357:Macf1 UTSW 4 123,351,776 (GRCm39) missense probably damaging 1.00
R0398:Macf1 UTSW 4 123,244,810 (GRCm39) missense probably damaging 1.00
R0413:Macf1 UTSW 4 123,366,062 (GRCm39) missense probably benign
R0426:Macf1 UTSW 4 123,377,453 (GRCm39) nonsense probably null
R0441:Macf1 UTSW 4 123,259,148 (GRCm39) splice site probably null
R0453:Macf1 UTSW 4 123,338,737 (GRCm39) missense probably benign 0.35
R0481:Macf1 UTSW 4 123,377,815 (GRCm39) splice site probably null
R0502:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0503:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0519:Macf1 UTSW 4 123,365,113 (GRCm39) missense probably benign 0.03
R0543:Macf1 UTSW 4 123,270,171 (GRCm39) missense probably damaging 1.00
R0621:Macf1 UTSW 4 123,274,327 (GRCm39) missense probably damaging 1.00
R0631:Macf1 UTSW 4 123,349,317 (GRCm39) nonsense probably null
R0720:Macf1 UTSW 4 123,326,718 (GRCm39) missense probably damaging 1.00
R0730:Macf1 UTSW 4 123,276,323 (GRCm39) splice site probably benign
R0755:Macf1 UTSW 4 123,263,719 (GRCm39) missense probably damaging 0.99
R0836:Macf1 UTSW 4 123,388,675 (GRCm39) critical splice donor site probably null
R0847:Macf1 UTSW 4 123,293,159 (GRCm39) missense probably benign 0.03
R0850:Macf1 UTSW 4 123,368,195 (GRCm39) missense probably benign
R0924:Macf1 UTSW 4 123,279,271 (GRCm39) missense probably damaging 1.00
R0973:Macf1 UTSW 4 123,369,793 (GRCm39) missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123,367,609 (GRCm39) missense probably damaging 1.00
R1076:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R1253:Macf1 UTSW 4 123,351,760 (GRCm39) missense probably damaging 1.00
R1301:Macf1 UTSW 4 123,380,451 (GRCm39) splice site probably benign
R1337:Macf1 UTSW 4 123,370,068 (GRCm39) missense probably benign 0.34
R1344:Macf1 UTSW 4 123,327,246 (GRCm39) missense probably damaging 0.99
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1443:Macf1 UTSW 4 123,404,800 (GRCm39) missense probably damaging 1.00
R1452:Macf1 UTSW 4 123,387,791 (GRCm39) missense probably benign
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1483:Macf1 UTSW 4 123,404,770 (GRCm39) missense probably damaging 1.00
R1509:Macf1 UTSW 4 123,577,802 (GRCm39) missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123,328,555 (GRCm39) missense probably null 1.00
R1515:Macf1 UTSW 4 123,272,273 (GRCm39) missense probably damaging 1.00
R1524:Macf1 UTSW 4 123,326,323 (GRCm39) missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123,369,807 (GRCm39) missense probably benign 0.30
R1535:Macf1 UTSW 4 123,334,486 (GRCm39) missense probably benign 0.05
R1556:Macf1 UTSW 4 123,348,813 (GRCm39) missense probably damaging 1.00
R1564:Macf1 UTSW 4 123,353,150 (GRCm39) missense probably benign 0.00
R1586:Macf1 UTSW 4 123,403,639 (GRCm39) missense probably benign 0.20
R1626:Macf1 UTSW 4 123,365,327 (GRCm39) missense probably benign
R1629:Macf1 UTSW 4 123,402,208 (GRCm39) nonsense probably null
R1649:Macf1 UTSW 4 123,377,846 (GRCm39) missense probably damaging 0.96
R1650:Macf1 UTSW 4 123,350,393 (GRCm39) nonsense probably null
R1706:Macf1 UTSW 4 123,264,377 (GRCm39) critical splice donor site probably null
R1713:Macf1 UTSW 4 123,272,487 (GRCm39) missense probably damaging 1.00
R1716:Macf1 UTSW 4 123,295,196 (GRCm39) missense probably damaging 1.00
R1744:Macf1 UTSW 4 123,369,646 (GRCm39) missense probably damaging 1.00
R1752:Macf1 UTSW 4 123,377,465 (GRCm39) missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123,405,901 (GRCm39) missense probably damaging 1.00
R1812:Macf1 UTSW 4 123,325,817 (GRCm39) missense probably damaging 1.00
R1818:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R1853:Macf1 UTSW 4 123,406,513 (GRCm39) splice site probably null
R1856:Macf1 UTSW 4 123,263,641 (GRCm39) missense probably damaging 1.00
R1869:Macf1 UTSW 4 123,244,921 (GRCm39) missense probably damaging 1.00
R1880:Macf1 UTSW 4 123,332,384 (GRCm39) missense probably damaging 1.00
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1902:Macf1 UTSW 4 123,364,958 (GRCm39) missense probably benign 0.01
R1907:Macf1 UTSW 4 123,266,192 (GRCm39) missense probably damaging 1.00
R1908:Macf1 UTSW 4 123,351,634 (GRCm39) missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123,345,830 (GRCm39) missense probably damaging 1.00
R1944:Macf1 UTSW 4 123,264,459 (GRCm39) missense probably damaging 1.00
R1945:Macf1 UTSW 4 123,384,453 (GRCm39) nonsense probably null
R1975:Macf1 UTSW 4 123,383,005 (GRCm39) missense probably damaging 1.00
R1989:Macf1 UTSW 4 123,391,519 (GRCm39) critical splice donor site probably null
R1991:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R1992:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R2013:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R2021:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2022:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2023:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2024:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2025:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2027:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2049:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2060:Macf1 UTSW 4 123,393,712 (GRCm39) splice site probably null
R2092:Macf1 UTSW 4 123,276,971 (GRCm39) missense probably damaging 1.00
R2100:Macf1 UTSW 4 123,291,699 (GRCm39) nonsense probably null
R2128:Macf1 UTSW 4 123,386,567 (GRCm39) missense probably benign 0.11
R2129:Macf1 UTSW 4 123,262,608 (GRCm39) splice site probably benign
R2140:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2142:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2182:Macf1 UTSW 4 123,386,464 (GRCm39) missense probably damaging 0.98
R2185:Macf1 UTSW 4 123,369,349 (GRCm39) missense probably damaging 0.99
R2190:Macf1 UTSW 4 123,353,005 (GRCm39) missense probably benign 0.11
R2320:Macf1 UTSW 4 123,333,288 (GRCm39) missense probably benign 0.02
R2382:Macf1 UTSW 4 123,268,625 (GRCm39) missense probably damaging 1.00
R2429:Macf1 UTSW 4 123,326,377 (GRCm39) missense probably damaging 0.99
R2432:Macf1 UTSW 4 123,577,789 (GRCm39) missense probably damaging 1.00
R2484:Macf1 UTSW 4 123,367,465 (GRCm39) missense probably damaging 1.00
R2842:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R2912:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2913:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2914:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2938:Macf1 UTSW 4 123,326,695 (GRCm39) missense probably damaging 0.99
R3082:Macf1 UTSW 4 123,255,236 (GRCm39) splice site probably null
R3086:Macf1 UTSW 4 123,328,901 (GRCm39) missense probably benign 0.00
R3408:Macf1 UTSW 4 123,275,574 (GRCm39) missense probably damaging 1.00
R3499:Macf1 UTSW 4 123,421,098 (GRCm39) nonsense probably null
R3696:Macf1 UTSW 4 123,350,155 (GRCm39) missense probably damaging 1.00
R3716:Macf1 UTSW 4 123,367,295 (GRCm39) missense probably benign 0.01
R3727:Macf1 UTSW 4 123,353,104 (GRCm39) missense probably damaging 1.00
R3770:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3813:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3825:Macf1 UTSW 4 123,338,744 (GRCm39) missense probably benign 0.11
R3893:Macf1 UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
R3896:Macf1 UTSW 4 123,364,987 (GRCm39) missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123,274,213 (GRCm39) missense probably damaging 1.00
R4031:Macf1 UTSW 4 123,275,105 (GRCm39) missense probably damaging 1.00
R4052:Macf1 UTSW 4 123,365,810 (GRCm39) missense probably benign 0.00
R4077:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4078:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4084:Macf1 UTSW 4 123,343,865 (GRCm39) missense probably damaging 0.98
R4094:Macf1 UTSW 4 123,353,062 (GRCm39) missense probably benign 0.00
R4154:Macf1 UTSW 4 123,365,606 (GRCm39) missense probably damaging 1.00
R4190:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123,326,185 (GRCm39) missense probably damaging 1.00
R4299:Macf1 UTSW 4 123,293,199 (GRCm39) missense probably damaging 1.00
R4326:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4327:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4355:Macf1 UTSW 4 123,368,884 (GRCm39) missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123,248,285 (GRCm39) intron probably benign
R4422:Macf1 UTSW 4 123,359,839 (GRCm39) missense probably damaging 0.96
R4436:Macf1 UTSW 4 123,421,135 (GRCm39) missense probably benign 0.03
R4472:Macf1 UTSW 4 123,289,782 (GRCm39) missense probably damaging 1.00
R4515:Macf1 UTSW 4 123,387,781 (GRCm39) missense probably damaging 1.00
R4549:Macf1 UTSW 4 123,367,486 (GRCm39) missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4622:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4623:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4630:Macf1 UTSW 4 123,367,432 (GRCm39) missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123,367,420 (GRCm39) missense probably benign 0.01
R4650:Macf1 UTSW 4 123,367,412 (GRCm39) missense probably benign 0.00
R4674:Macf1 UTSW 4 123,366,190 (GRCm39) missense probably benign 0.22
R4751:Macf1 UTSW 4 123,365,443 (GRCm39) missense probably benign 0.01
R4762:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R4776:Macf1 UTSW 4 123,369,808 (GRCm39) missense probably benign 0.00
R4777:Macf1 UTSW 4 123,270,295 (GRCm39) missense probably damaging 1.00
R4860:Macf1 UTSW 4 123,380,543 (GRCm39) missense probably damaging 1.00
R4865:Macf1 UTSW 4 123,327,096 (GRCm39) missense probably damaging 1.00
R4867:Macf1 UTSW 4 123,365,993 (GRCm39) missense probably damaging 0.97
R4884:Macf1 UTSW 4 123,348,802 (GRCm39) missense probably benign 0.02
R4890:Macf1 UTSW 4 123,342,031 (GRCm39) missense probably damaging 1.00
R4913:Macf1 UTSW 4 123,393,682 (GRCm39) missense probably damaging 1.00
R4925:Macf1 UTSW 4 123,420,445 (GRCm39) missense probably benign
R4948:Macf1 UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
R4958:Macf1 UTSW 4 123,369,157 (GRCm39) missense probably damaging 0.99
R4986:Macf1 UTSW 4 123,284,914 (GRCm39) missense probably damaging 1.00
R4999:Macf1 UTSW 4 123,388,702 (GRCm39) missense probably benign 0.14
R5004:Macf1 UTSW 4 123,279,268 (GRCm39) missense probably damaging 1.00
R5017:Macf1 UTSW 4 123,345,906 (GRCm39) missense probably damaging 1.00
R5018:Macf1 UTSW 4 123,279,392 (GRCm39) missense probably damaging 1.00
R5026:Macf1 UTSW 4 123,333,287 (GRCm39) missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123,349,312 (GRCm39) missense probably damaging 0.97
R5039:Macf1 UTSW 4 123,405,013 (GRCm39) missense probably damaging 1.00
R5041:Macf1 UTSW 4 123,290,839 (GRCm39) splice site probably null
R5100:Macf1 UTSW 4 123,368,261 (GRCm39) missense probably benign 0.11
R5110:Macf1 UTSW 4 123,261,801 (GRCm39) missense probably damaging 0.99
R5122:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R5187:Macf1 UTSW 4 123,365,882 (GRCm39) missense probably benign 0.00
R5191:Macf1 UTSW 4 123,366,755 (GRCm39) missense probably benign 0.00
R5201:Macf1 UTSW 4 123,369,738 (GRCm39) nonsense probably null
R5236:Macf1 UTSW 4 123,291,614 (GRCm39) missense probably damaging 1.00
R5248:Macf1 UTSW 4 123,295,567 (GRCm39) nonsense probably null
R5251:Macf1 UTSW 4 123,343,760 (GRCm39) missense probably benign 0.20
R5319:Macf1 UTSW 4 123,367,229 (GRCm39) missense probably damaging 1.00
R5326:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5327:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5328:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5350:Macf1 UTSW 4 123,421,251 (GRCm39) start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123,365,546 (GRCm39) missense probably damaging 0.98
R5419:Macf1 UTSW 4 123,290,917 (GRCm39) missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123,278,661 (GRCm39) missense probably damaging 1.00
R5432:Macf1 UTSW 4 123,353,129 (GRCm39) nonsense probably null
R5466:Macf1 UTSW 4 123,346,658 (GRCm39) missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123,343,854 (GRCm39) missense probably benign
R5564:Macf1 UTSW 4 123,420,538 (GRCm39) missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123,328,957 (GRCm39) missense probably damaging 0.98
R5597:Macf1 UTSW 4 123,433,570 (GRCm39) intron probably benign
R5669:Macf1 UTSW 4 123,370,018 (GRCm39) missense probably damaging 1.00
R5682:Macf1 UTSW 4 123,328,552 (GRCm39) missense probably damaging 1.00
R5701:Macf1 UTSW 4 123,397,018 (GRCm39) missense probably damaging 1.00
R5715:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R5760:Macf1 UTSW 4 123,407,677 (GRCm39) missense probably damaging 1.00
R5806:Macf1 UTSW 4 123,265,680 (GRCm39) missense probably damaging 1.00
R5838:Macf1 UTSW 4 123,345,947 (GRCm39) missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123,275,117 (GRCm39) missense probably damaging 1.00
R5850:Macf1 UTSW 4 123,401,099 (GRCm39) missense probably damaging 1.00
R5875:Macf1 UTSW 4 123,326,107 (GRCm39) missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123,290,951 (GRCm39) missense probably damaging 1.00
R5913:Macf1 UTSW 4 123,369,832 (GRCm39) missense probably damaging 1.00
R5921:Macf1 UTSW 4 123,420,504 (GRCm39) missense probably benign
R5940:Macf1 UTSW 4 123,326,674 (GRCm39) missense probably damaging 1.00
R5950:Macf1 UTSW 4 123,333,229 (GRCm39) splice site probably null
R6005:Macf1 UTSW 4 123,368,068 (GRCm39) missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123,401,126 (GRCm39) missense probably damaging 1.00
R6041:Macf1 UTSW 4 123,407,641 (GRCm39) missense probably damaging 1.00
R6057:Macf1 UTSW 4 123,404,536 (GRCm39) missense probably damaging 0.98
R6156:Macf1 UTSW 4 123,366,073 (GRCm39) missense probably benign 0.00
R6186:Macf1 UTSW 4 123,377,968 (GRCm39) missense probably damaging 1.00
R6197:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R6262:Macf1 UTSW 4 123,366,983 (GRCm39) missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123,326,668 (GRCm39) missense probably damaging 1.00
R6340:Macf1 UTSW 4 123,342,042 (GRCm39) missense probably benign 0.13
R6369:Macf1 UTSW 4 123,304,355 (GRCm39) missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123,386,988 (GRCm39) missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123,295,387 (GRCm39) splice site probably null
R6501:Macf1 UTSW 4 123,363,425 (GRCm39) splice site probably null
R6508:Macf1 UTSW 4 123,363,535 (GRCm39) missense probably damaging 0.96
R6519:Macf1 UTSW 4 123,366,118 (GRCm39) missense probably benign 0.13
R6535:Macf1 UTSW 4 123,365,728 (GRCm39) missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123,386,518 (GRCm39) missense probably damaging 1.00
R6546:Macf1 UTSW 4 123,326,074 (GRCm39) missense probably benign 0.14
R6583:Macf1 UTSW 4 123,364,739 (GRCm39) splice site probably null
R6597:Macf1 UTSW 4 123,276,485 (GRCm39) missense probably damaging 1.00
R6693:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123,403,596 (GRCm39) missense probably damaging 1.00
R6704:Macf1 UTSW 4 123,304,555 (GRCm39) intron probably benign
R6716:Macf1 UTSW 4 123,402,231 (GRCm39) missense probably damaging 1.00
R6789:Macf1 UTSW 4 123,266,231 (GRCm39) missense probably damaging 1.00
R6807:Macf1 UTSW 4 123,268,208 (GRCm39) missense probably damaging 1.00
R6825:Macf1 UTSW 4 123,277,015 (GRCm39) splice site probably null
R6881:Macf1 UTSW 4 123,326,246 (GRCm39) missense probably damaging 1.00
R6894:Macf1 UTSW 4 123,377,480 (GRCm39) missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123,421,145 (GRCm39) missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123,334,515 (GRCm39) missense probably benign 0.01
R6965:Macf1 UTSW 4 123,302,538 (GRCm39) missense probably benign 0.38
R6969:Macf1 UTSW 4 123,351,593 (GRCm39) missense probably benign 0.01
R7032:Macf1 UTSW 4 123,366,101 (GRCm39) missense probably benign 0.00
R7055:Macf1 UTSW 4 123,302,989 (GRCm39) missense probably benign 0.01
R7078:Macf1 UTSW 4 123,325,936 (GRCm39) missense probably damaging 0.99
R7215:Macf1 UTSW 4 123,401,097 (GRCm39) missense probably damaging 1.00
R7263:Macf1 UTSW 4 123,271,943 (GRCm39) missense probably damaging 1.00
R7265:Macf1 UTSW 4 123,301,670 (GRCm39) missense probably benign 0.00
R7278:Macf1 UTSW 4 123,334,536 (GRCm39) missense possibly damaging 0.87
R7312:Macf1 UTSW 4 123,400,130 (GRCm39) missense probably damaging 1.00
R7324:Macf1 UTSW 4 123,268,218 (GRCm39) missense probably benign 0.09
R7334:Macf1 UTSW 4 123,293,235 (GRCm39) missense probably damaging 1.00
R7342:Macf1 UTSW 4 123,275,917 (GRCm39) missense probably damaging 1.00
R7409:Macf1 UTSW 4 123,398,263 (GRCm39) missense probably damaging 1.00
R7436:Macf1 UTSW 4 123,350,436 (GRCm39) missense probably benign
R7440:Macf1 UTSW 4 123,349,239 (GRCm39) nonsense probably null
R7462:Macf1 UTSW 4 123,386,556 (GRCm39) missense probably damaging 1.00
R7471:Macf1 UTSW 4 123,366,082 (GRCm39) missense probably benign 0.00
R7472:Macf1 UTSW 4 123,326,860 (GRCm39) missense probably benign 0.16
R7486:Macf1 UTSW 4 123,303,374 (GRCm39) missense probably benign 0.00
R7492:Macf1 UTSW 4 123,369,524 (GRCm39) missense possibly damaging 0.83
R7511:Macf1 UTSW 4 123,367,093 (GRCm39) missense possibly damaging 0.72
R7528:Macf1 UTSW 4 123,325,852 (GRCm39) missense possibly damaging 0.90
R7547:Macf1 UTSW 4 123,335,410 (GRCm39) missense probably damaging 1.00
R7592:Macf1 UTSW 4 123,304,686 (GRCm39) intron probably benign
R7723:Macf1 UTSW 4 123,326,717 (GRCm39) missense probably benign 0.00
R7731:Macf1 UTSW 4 123,338,672 (GRCm39) missense probably benign 0.19
R7739:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R7740:Macf1 UTSW 4 123,578,096 (GRCm39) start gained probably benign
R7798:Macf1 UTSW 4 123,271,893 (GRCm39) missense probably damaging 1.00
R7799:Macf1 UTSW 4 123,420,906 (GRCm39) missense probably benign 0.00
R7801:Macf1 UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
R7842:Macf1 UTSW 4 123,420,702 (GRCm39) missense probably benign 0.12
R7849:Macf1 UTSW 4 123,301,392 (GRCm39) missense probably benign 0.00
R7873:Macf1 UTSW 4 123,398,344 (GRCm39) critical splice acceptor site probably null
R7933:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
R7934:Macf1 UTSW 4 123,367,727 (GRCm39) missense possibly damaging 0.89
R7947:Macf1 UTSW 4 123,295,200 (GRCm39) missense probably damaging 0.98
R7988:Macf1 UTSW 4 123,400,273 (GRCm39) missense probably damaging 1.00
R7992:Macf1 UTSW 4 123,289,753 (GRCm39) missense probably damaging 1.00
R8013:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8014:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8029:Macf1 UTSW 4 123,338,685 (GRCm39) missense possibly damaging 0.50
R8064:Macf1 UTSW 4 123,353,167 (GRCm39) missense possibly damaging 0.91
R8085:Macf1 UTSW 4 123,303,875 (GRCm39) missense possibly damaging 0.46
R8094:Macf1 UTSW 4 123,263,660 (GRCm39) missense probably damaging 0.99
R8099:Macf1 UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
R8147:Macf1 UTSW 4 123,385,491 (GRCm39) missense probably damaging 1.00
R8151:Macf1 UTSW 4 123,291,206 (GRCm39) missense possibly damaging 0.91
R8186:Macf1 UTSW 4 123,275,923 (GRCm39) missense possibly damaging 0.89
R8186:Macf1 UTSW 4 123,266,219 (GRCm39) missense probably damaging 1.00
R8192:Macf1 UTSW 4 123,334,390 (GRCm39) missense probably damaging 1.00
R8196:Macf1 UTSW 4 123,276,497 (GRCm39) missense probably damaging 1.00
R8260:Macf1 UTSW 4 123,365,863 (GRCm39) missense probably benign
R8305:Macf1 UTSW 4 123,289,414 (GRCm39) intron probably benign
R8333:Macf1 UTSW 4 123,279,245 (GRCm39) splice site probably null
R8334:Macf1 UTSW 4 123,325,901 (GRCm39) missense possibly damaging 0.82
R8344:Macf1 UTSW 4 123,420,649 (GRCm39) missense probably benign
R8344:Macf1 UTSW 4 123,278,476 (GRCm39) missense probably damaging 1.00
R8422:Macf1 UTSW 4 123,303,279 (GRCm39) missense possibly damaging 0.46
R8459:Macf1 UTSW 4 123,374,107 (GRCm39) missense possibly damaging 0.68
R8466:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R8472:Macf1 UTSW 4 123,346,795 (GRCm39) missense probably damaging 1.00
R8556:Macf1 UTSW 4 123,382,136 (GRCm39) missense probably damaging 1.00
R8679:Macf1 UTSW 4 123,405,869 (GRCm39) missense probably benign 0.00
R8723:Macf1 UTSW 4 123,348,910 (GRCm39) nonsense probably null
R8732:Macf1 UTSW 4 123,403,563 (GRCm39) critical splice donor site probably null
R8747:Macf1 UTSW 4 123,248,944 (GRCm39) missense probably damaging 1.00
R8748:Macf1 UTSW 4 123,368,068 (GRCm39) missense probably benign 0.00
R8785:Macf1 UTSW 4 123,342,053 (GRCm39) critical splice acceptor site probably null
R8826:Macf1 UTSW 4 123,276,022 (GRCm39) missense probably damaging 1.00
R8828:Macf1 UTSW 4 123,302,204 (GRCm39) missense probably benign 0.01
R8833:Macf1 UTSW 4 123,365,134 (GRCm39) missense probably benign
R8889:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8892:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8893:Macf1 UTSW 4 123,304,323 (GRCm39) missense probably benign 0.27
R8899:Macf1 UTSW 4 123,368,852 (GRCm39) missense probably benign 0.00
R8956:Macf1 UTSW 4 123,368,641 (GRCm39) missense probably benign
R9037:Macf1 UTSW 4 123,365,518 (GRCm39) missense probably benign 0.03
R9086:Macf1 UTSW 4 123,377,944 (GRCm39) missense probably damaging 1.00
R9111:Macf1 UTSW 4 123,406,819 (GRCm39) missense probably damaging 1.00
R9126:Macf1 UTSW 4 123,276,193 (GRCm39) missense possibly damaging 0.88
R9139:Macf1 UTSW 4 123,328,564 (GRCm39) missense probably damaging 1.00
R9140:Macf1 UTSW 4 123,367,855 (GRCm39) missense possibly damaging 0.92
R9149:Macf1 UTSW 4 123,365,326 (GRCm39) missense probably benign 0.40
R9163:Macf1 UTSW 4 123,403,686 (GRCm39) missense probably damaging 1.00
R9177:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9206:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9208:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9209:Macf1 UTSW 4 123,326,227 (GRCm39) missense probably damaging 1.00
R9219:Macf1 UTSW 4 123,301,554 (GRCm39) missense possibly damaging 0.81
R9224:Macf1 UTSW 4 123,326,690 (GRCm39) missense probably damaging 1.00
R9241:Macf1 UTSW 4 123,271,952 (GRCm39) missense probably damaging 1.00
R9268:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9276:Macf1 UTSW 4 123,328,501 (GRCm39) missense probably damaging 1.00
R9296:Macf1 UTSW 4 123,400,246 (GRCm39) missense probably damaging 0.99
R9369:Macf1 UTSW 4 123,349,150 (GRCm39) critical splice donor site probably null
R9438:Macf1 UTSW 4 123,279,366 (GRCm39) missense probably benign 0.01
R9443:Macf1 UTSW 4 123,365,668 (GRCm39) missense probably benign
R9529:Macf1 UTSW 4 123,407,680 (GRCm39) missense probably damaging 1.00
R9600:Macf1 UTSW 4 123,365,002 (GRCm39) missense possibly damaging 0.76
R9613:Macf1 UTSW 4 123,420,288 (GRCm39) missense probably benign 0.41
R9686:Macf1 UTSW 4 123,377,491 (GRCm39) missense possibly damaging 0.64
R9689:Macf1 UTSW 4 123,365,654 (GRCm39) missense probably benign
R9740:Macf1 UTSW 4 123,366,853 (GRCm39) missense probably damaging 1.00
R9740:Macf1 UTSW 4 123,266,177 (GRCm39) missense probably damaging 1.00
R9764:Macf1 UTSW 4 123,366,136 (GRCm39) missense probably benign 0.02
R9779:Macf1 UTSW 4 123,348,789 (GRCm39) missense probably benign 0.02
RF011:Macf1 UTSW 4 123,367,648 (GRCm39) missense probably damaging 1.00
X0022:Macf1 UTSW 4 123,343,835 (GRCm39) missense probably damaging 0.99
X0027:Macf1 UTSW 4 123,397,062 (GRCm39) missense probably damaging 1.00
X0064:Macf1 UTSW 4 123,405,667 (GRCm39) missense probably damaging 1.00
Z1177:Macf1 UTSW 4 123,365,268 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGAGTCCTTAAGTCCATGAACTATAG -3'
(R):5'- TTTCTGACAGGTAGGATGGCC -3'

Sequencing Primer
(F):5'- TTATTCACTTCACATCCCAATCACAG -3'
(R):5'- AGGATGGCCCAATATTTGCC -3'
Posted On 2016-03-01