Incidental Mutation 'R4860:Mapk10'
ID 372397
Institutional Source Beutler Lab
Gene Symbol Mapk10
Ensembl Gene ENSMUSG00000046709
Gene Name mitogen-activated protein kinase 10
Synonyms p493F12, JNK3, Serk2, C230008H04Rik
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 102907948-103211334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102990619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000108469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086854] [ENSMUST00000112846] [ENSMUST00000112847] [ENSMUST00000112848] [ENSMUST00000128869] [ENSMUST00000133069] [ENSMUST00000141573] [ENSMUST00000170792]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000086854
AA Change: D150G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084065
Gene: ENSMUSG00000046709
AA Change: D150G

DomainStartEndE-ValueType
S_TKc 64 359 5.76e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112846
AA Change: D150G

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108467
Gene: ENSMUSG00000046709
AA Change: D150G

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112847
AA Change: D150G

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108468
Gene: ENSMUSG00000046709
AA Change: D150G

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
low complexity region 423 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112848
AA Change: D180G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108469
Gene: ENSMUSG00000046709
AA Change: D180G

DomainStartEndE-ValueType
S_TKc 94 389 4.37e-88 SMART
low complexity region 453 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128869
AA Change: D76G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143448
Gene: ENSMUSG00000046709
AA Change: D76G

DomainStartEndE-ValueType
S_TKc 4 178 7.4e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133069
AA Change: D150G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143609
Gene: ENSMUSG00000046709
AA Change: D150G

DomainStartEndE-ValueType
S_TKc 64 252 1.4e-9 SMART
Predicted Effect silent
Transcript: ENSMUST00000141573
SMART Domains Protein: ENSMUSP00000142798
Gene: ENSMUSG00000046709

DomainStartEndE-ValueType
Pfam:Pkinase 64 125 1.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170792
AA Change: D150G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127193
Gene: ENSMUSG00000046709
AA Change: D150G

DomainStartEndE-ValueType
S_TKc 64 359 4.37e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199275
Meta Mutation Damage Score 0.7281 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals and are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. They are resistant to kainic acid induced seizures and show increased resistance to MPTP induced Parkinson's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 (GRCm38) S466P possibly damaging Het
Ablim1 T C 19: 57,079,866 (GRCm38) T267A probably damaging Het
Acap2 A T 16: 31,103,499 (GRCm38) L724Q possibly damaging Het
Acsbg3 A G 17: 56,888,655 (GRCm38) N684S probably benign Het
Adcy4 T C 14: 55,781,927 (GRCm38) T89A possibly damaging Het
Agrp T C 8: 105,567,368 (GRCm38) E41G probably benign Het
Ajm1 T C 2: 25,578,753 (GRCm38) Y382C probably damaging Het
Akr1d1 G A 6: 37,564,491 (GRCm38) V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 (GRCm38) R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 (GRCm38) V692E probably damaging Het
Arid5b G T 10: 68,243,095 (GRCm38) N137K probably damaging Het
Arsi G A 18: 60,916,651 (GRCm38) G202E probably benign Het
BC048679 T C 7: 81,495,720 (GRCm38) N27D probably benign Het
Ccdc78 A G 17: 25,788,700 (GRCm38) N237S probably benign Het
Cd46 G A 1: 195,062,396 (GRCm38) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm38) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 (GRCm38) E731G probably damaging Het
Ctsh A G 9: 90,054,548 (GRCm38) E26G probably benign Het
Cul1 T A 6: 47,517,191 (GRCm38) S479R probably damaging Het
Cul1 G T 6: 47,517,146 (GRCm38) K464N probably benign Het
Dcaf5 A T 12: 80,340,232 (GRCm38) D373E probably benign Het
Dhcr7 A G 7: 143,840,500 (GRCm38) Q126R probably benign Het
Dok2 T C 14: 70,777,516 (GRCm38) F228L probably damaging Het
Dpep3 T G 8: 105,976,189 (GRCm38) I314L probably benign Het
Eps8 A G 6: 137,514,295 (GRCm38) F362L probably damaging Het
Espn G T 4: 152,138,846 (GRCm38) R250S probably damaging Het
Faf1 A C 4: 109,742,896 (GRCm38) N163H probably damaging Het
Fcho1 C T 8: 71,710,481 (GRCm38) V635I probably benign Het
Garin5b C T 7: 4,757,469 (GRCm38) probably null Het
Gask1b C A 3: 79,936,674 (GRCm38) S36* probably null Het
Gm7579 G A 7: 142,211,908 (GRCm38) C17Y unknown Het
Gpx8 G T 13: 113,045,508 (GRCm38) Y130* probably null Het
Gvin1 A T 7: 106,163,436 (GRCm38) Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 (GRCm38) M30K probably benign Het
Iqub T C 6: 24,450,842 (GRCm38) D586G probably damaging Het
Klhl25 T C 7: 75,867,050 (GRCm38) I568T probably benign Het
Larp6 A G 9: 60,737,810 (GRCm38) E411G probably damaging Het
Lepr A C 4: 101,789,337 (GRCm38) I822L probably benign Het
Lrig3 C A 10: 126,011,052 (GRCm38) D896E probably benign Het
Lrp1 C T 10: 127,553,824 (GRCm38) G3114D probably damaging Het
Lyset A T 12: 102,744,055 (GRCm38) probably benign Het
Macf1 A T 4: 123,486,750 (GRCm38) Y1263N probably damaging Het
Matr3 T A 18: 35,581,640 (GRCm38) V113E probably damaging Het
Mbd4 A T 6: 115,848,926 (GRCm38) F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 (GRCm38) R238W probably benign Het
Mcrip2 G T 17: 25,864,647 (GRCm38) T86N possibly damaging Het
Mink1 A G 11: 70,611,592 (GRCm38) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 (GRCm38) T1128I probably benign Het
Nrg2 T A 18: 36,196,547 (GRCm38) Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 (GRCm38) M149T probably benign Het
Or4d2b T A 11: 87,889,225 (GRCm38) M224L probably damaging Het
Or8d6 G T 9: 39,942,504 (GRCm38) M81I probably benign Het
Or8j3c T C 2: 86,422,957 (GRCm38) T240A probably damaging Het
Pax3 A G 1: 78,192,456 (GRCm38) I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 (GRCm38) N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 (GRCm38) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 (GRCm38) S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 (GRCm38) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 (GRCm38) T91A probably benign Het
Ptger4 G T 15: 5,242,606 (GRCm38) N177K probably benign Het
Reln A G 5: 21,901,751 (GRCm38) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm38) S644R probably damaging Het
Ripk4 C T 16: 97,751,536 (GRCm38) R194H probably damaging Het
Rnf112 A T 11: 61,452,744 (GRCm38) C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 (GRCm38) Y278* probably null Het
Sel1l A G 12: 91,831,602 (GRCm38) L140P probably damaging Het
Shroom3 G T 5: 92,943,086 (GRCm38) V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 (GRCm38) V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 (GRCm38) T131A probably damaging Het
Slmap A T 14: 26,460,209 (GRCm38) V323E probably benign Het
Smim6 T C 11: 115,913,504 (GRCm38) V39A probably benign Het
Sorbs1 T C 19: 40,337,005 (GRCm38) T382A probably benign Het
Sparc G A 11: 55,399,211 (GRCm38) T218I possibly damaging Het
Steap1 A T 5: 5,736,589 (GRCm38) F283I probably damaging Het
Stil A G 4: 115,038,474 (GRCm38) T586A probably benign Het
Tbce T A 13: 14,019,795 (GRCm38) D93V probably damaging Het
Tcf12 C T 9: 71,858,840 (GRCm38) G504S probably null Het
Tex55 A G 16: 38,828,145 (GRCm38) S201P probably damaging Het
Tle4 A T 19: 14,464,345 (GRCm38) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm38) F254S probably damaging Het
Tubgcp3 T C 8: 12,649,722 (GRCm38) K377R probably benign Het
Ush2a A T 1: 188,553,275 (GRCm38) T2003S probably benign Het
Usp53 A G 3: 122,961,363 (GRCm38) S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 (GRCm38) L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 (GRCm38) Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 (GRCm38) I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 (GRCm38) D836V probably damaging Het
Vps13d A G 4: 145,087,161 (GRCm38) F165L probably benign Het
Vstm4 A G 14: 32,863,785 (GRCm38) E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 (GRCm38) C339* probably null Het
Other mutations in Mapk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Mapk10 APN 5 102,926,152 (GRCm38) splice site probably benign
IGL01791:Mapk10 APN 5 102,996,648 (GRCm38) missense probably damaging 1.00
IGL01885:Mapk10 APN 5 102,996,589 (GRCm38) missense probably damaging 1.00
IGL02192:Mapk10 APN 5 102,989,647 (GRCm38) missense probably damaging 0.97
IGL02260:Mapk10 APN 5 103,038,668 (GRCm38) missense probably benign 0.09
IGL02409:Mapk10 APN 5 102,928,230 (GRCm38) missense possibly damaging 0.50
IGL03148:Mapk10 APN 5 102,926,105 (GRCm38) missense probably damaging 1.00
R0904:Mapk10 UTSW 5 102,987,280 (GRCm38) splice site probably benign
R1067:Mapk10 UTSW 5 102,991,857 (GRCm38) splice site probably benign
R1592:Mapk10 UTSW 5 103,038,621 (GRCm38) missense possibly damaging 0.89
R1812:Mapk10 UTSW 5 102,913,262 (GRCm38) missense probably damaging 1.00
R2364:Mapk10 UTSW 5 103,038,641 (GRCm38) missense possibly damaging 0.81
R2866:Mapk10 UTSW 5 103,038,682 (GRCm38) missense probably benign 0.25
R2867:Mapk10 UTSW 5 103,038,682 (GRCm38) missense probably benign 0.25
R2867:Mapk10 UTSW 5 103,038,682 (GRCm38) missense probably benign 0.25
R4622:Mapk10 UTSW 5 102,989,724 (GRCm38) missense probably damaging 1.00
R4860:Mapk10 UTSW 5 102,990,619 (GRCm38) missense probably damaging 1.00
R4866:Mapk10 UTSW 5 102,963,525 (GRCm38) missense probably damaging 1.00
R5901:Mapk10 UTSW 5 102,913,292 (GRCm38) missense probably damaging 1.00
R5986:Mapk10 UTSW 5 103,038,580 (GRCm38) missense probably benign 0.33
R6000:Mapk10 UTSW 5 102,966,476 (GRCm38) missense probably damaging 1.00
R6000:Mapk10 UTSW 5 102,966,475 (GRCm38) missense probably damaging 1.00
R7375:Mapk10 UTSW 5 102,976,390 (GRCm38) missense probably null 0.26
R7460:Mapk10 UTSW 5 103,038,577 (GRCm38) missense probably benign 0.37
R7753:Mapk10 UTSW 5 103,038,553 (GRCm38) nonsense probably null
R7879:Mapk10 UTSW 5 102,963,496 (GRCm38) missense probably benign 0.10
R7935:Mapk10 UTSW 5 102,991,926 (GRCm38) missense possibly damaging 0.92
R8059:Mapk10 UTSW 5 102,966,612 (GRCm38) missense probably damaging 1.00
R8846:Mapk10 UTSW 5 102,996,655 (GRCm38) missense probably damaging 1.00
R9030:Mapk10 UTSW 5 102,996,633 (GRCm38) missense probably damaging 1.00
R9043:Mapk10 UTSW 5 102,926,159 (GRCm38) splice site probably benign
R9106:Mapk10 UTSW 5 103,038,576 (GRCm38) missense probably damaging 1.00
R9115:Mapk10 UTSW 5 103,038,666 (GRCm38) missense
R9398:Mapk10 UTSW 5 102,913,286 (GRCm38) missense probably damaging 1.00
R9620:Mapk10 UTSW 5 102,966,607 (GRCm38) missense probably damaging 1.00
R9796:Mapk10 UTSW 5 102,987,235 (GRCm38) missense possibly damaging 0.93
Z1176:Mapk10 UTSW 5 102,991,887 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTATTTGATCAACTCCGCTGG -3'
(R):5'- ATTCGGGCAGTGACTGAAGG -3'

Sequencing Primer
(F):5'- CTGGAGAAGGTAGCCCACTG -3'
(R):5'- ATTCTAGAGCAGTGGTCCTCAACG -3'
Posted On 2016-03-01