Mutagenetix > Incidental Mutation

Incidental Mutation 'R4860:Pik3c2a'

372414

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

042471-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4860 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 116340156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1649 (A1649V)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: A1649V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: A1649V

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205941

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: A1649V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206248

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206805

Meta Mutation Damage Score

0.2650

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,423	S466P	possibly damaging	Het
1700061G19Rik	A	G	17: 56,888,655	N684S	probably benign	Het
4930435E12Rik	A	G	16: 38,828,145	S201P	probably damaging	Het
Ablim1	T	C	19: 57,079,866	T267A	probably damaging	Het
Acap2	A	T	16: 31,103,499	L724Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Akr1d1	G	A	6: 37,564,491	V308M	probably damaging	Het
Ap1m2	C	T	9: 21,309,674	R54Q	probably benign	Het
Arhgap45	T	A	10: 80,027,066	V692E	probably damaging	Het
Arid5b	G	T	10: 68,243,095	N137K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
BC048679	T	C	7: 81,495,720	N27D	probably benign	Het
Ccdc78	A	G	17: 25,788,700	N237S	probably benign	Het
Cd46	G	A	1: 195,062,396	L345F	possibly damaging	Het
Cngb3	A	T	4: 19,425,569	N459I	possibly damaging	Het
Ctnnd2	A	G	15: 30,881,167	E731G	probably damaging	Het
Ctsh	A	G	9: 90,054,548	E26G	probably benign	Het
Cul1	T	A	6: 47,517,191	S479R	probably damaging	Het
Cul1	G	T	6: 47,517,146	K464N	probably benign	Het
Dcaf5	A	T	12: 80,340,232	D373E	probably benign	Het
Ddx58	G	T	4: 40,210,000	S644R	probably damaging	Het
Dhcr7	A	G	7: 143,840,500	Q126R	probably benign	Het
Dok2	T	C	14: 70,777,516	F228L	probably damaging	Het
Dpep3	T	G	8: 105,976,189	I314L	probably benign	Het
Eps8	A	G	6: 137,514,295	F362L	probably damaging	Het
Espn	G	T	4: 152,138,846	R250S	probably damaging	Het
Faf1	A	C	4: 109,742,896	N163H	probably damaging	Het
Fam198b	C	A	3: 79,936,674	S36*	probably null	Het
Fam71e2	C	T	7: 4,757,469		probably null	Het
Fcho1	C	T	8: 71,710,481	V635I	probably benign	Het
Gm7579	G	A	7: 142,211,908	C17Y	unknown	Het
Gm996	T	C	2: 25,578,753	Y382C	probably damaging	Het
Gpx8	G	T	13: 113,045,508	Y130*	probably null	Het
Gvin1	A	T	7: 106,163,436	Y609N	possibly damaging	Het
Hectd4	T	A	5: 121,305,818	M30K	probably benign	Het
Iqub	T	C	6: 24,450,842	D586G	probably damaging	Het
Klhl25	T	C	7: 75,867,050	I568T	probably benign	Het
Larp6	A	G	9: 60,737,810	E411G	probably damaging	Het
Lepr	A	C	4: 101,789,337	I822L	probably benign	Het
Lrig3	C	A	10: 126,011,052	D896E	probably benign	Het
Lrp1	C	T	10: 127,553,824	G3114D	probably damaging	Het
Macf1	A	T	4: 123,486,750	Y1263N	probably damaging	Het
Mapk10	T	C	5: 102,990,619	D180G	probably damaging	Het
Matr3	T	A	18: 35,581,640	V113E	probably damaging	Het
Mbd4	A	T	6: 115,848,926	F368Y	possibly damaging	Het
Mcpt8	G	A	14: 56,082,280	R238W	probably benign	Het
Mcrip2	G	T	17: 25,864,647	T86N	possibly damaging	Het
Mink1	A	G	11: 70,611,592	N1043S	probably damaging	Het
Muc4	G	A	16: 32,754,616	G1497R	probably benign	Het
Muc4	T	A	16: 32,754,625	S1500T	probably benign	Het
Nbeal2	G	A	9: 110,635,194	T1128I	probably benign	Het
Nrg2	T	A	18: 36,196,547	Y205F	probably damaging	Het
Nubp2	A	G	17: 24,884,456	M149T	probably benign	Het
Olfr1062	T	C	2: 86,422,957	T240A	probably damaging	Het
Olfr462	T	A	11: 87,889,225	M224L	probably damaging	Het
Olfr974	G	T	9: 39,942,504	M81I	probably benign	Het
Pax3	A	G	1: 78,192,456	I191T	possibly damaging	Het
Pdcd5	T	C	7: 35,643,710	N137D	possibly damaging	Het
Pkhd1l1	T	C	15: 44,537,378	S2183P	possibly damaging	Het
Plekho1	T	A	3: 95,988,993	Q388L	possibly damaging	Het
Ppfibp1	A	G	6: 146,990,514	T91A	probably benign	Het
Ptger4	G	T	15: 5,242,606	N177K	probably benign	Het
Reln	A	G	5: 21,901,751	F3207S	probably benign	Het
Ripk4	C	T	16: 97,751,536	R194H	probably damaging	Het
Rnf112	A	T	11: 61,452,744	C112S	possibly damaging	Het
Rprd1b	T	G	2: 158,074,935	Y278*	probably null	Het
Sel1l	A	G	12: 91,831,602	L140P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc38a3	A	G	9: 107,655,064	V423A	probably damaging	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Slmap	A	T	14: 26,460,209	V323E	probably benign	Het
Smim6	T	C	11: 115,913,504	V39A	probably benign	Het
Sorbs1	T	C	19: 40,337,005	T382A	probably benign	Het
Sparc	G	A	11: 55,399,211	T218I	possibly damaging	Het
Steap1	A	T	5: 5,736,589	F283I	probably damaging	Het
Stil	A	G	4: 115,038,474	T586A	probably benign	Het
Tbce	T	A	13: 14,019,795	D93V	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Tle4	A	T	19: 14,464,345	I435K	probably benign	Het
Tmem245	A	G	4: 56,899,164	F254S	probably damaging	Het
Tmem251	A	T	12: 102,744,055		probably benign	Het
Tubgcp3	T	C	8: 12,649,722	K377R	probably benign	Het
Ush2a	A	T	1: 188,553,275	T2003S	probably benign	Het
Usp53	A	G	3: 122,961,363	S32P	possibly damaging	Het
Vmn1r78	T	A	7: 12,152,756	L98Q	probably damaging	Het
Vmn2r116	A	C	17: 23,401,803	Q837P	probably benign	Het
Vmn2r3	T	C	3: 64,275,601	I226V	probably benign	Het
Vmn2r84	T	A	10: 130,385,843	D836V	probably damaging	Het
Vps13d	A	G	4: 145,087,161	F165L	probably benign	Het
Vstm4	A	G	14: 32,863,785	E103G	possibly damaging	Het
Zfp870	A	T	17: 32,883,340	C339*	probably null	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	116388096	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGACAGTTGGTCCAACATG -3'
(R):5'- TCTAGTCAGTGCCATTCATTGC -3'

Sequencing Primer
(F):5'- CTGACAGTTGGTCCAACATGTTAAG -3'
(R):5'- AGTCAGTGCCATTCATTGCATCAC -3'

Posted On

2016-03-01