Incidental Mutation 'R4860:Ctsh'
ID 372426
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Name cathepsin H
Synonyms Cat H
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4860 (G1)
Quality Score 155
Status Not validated
Chromosome 9
Chromosomal Location 89936320-89958148 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89936601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 26 (E26G)
Ref Sequence ENSEMBL: ENSMUSP00000117599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000185459]
AlphaFold P49935
Predicted Effect probably benign
Transcript: ENSMUST00000034915
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127842
Predicted Effect probably benign
Transcript: ENSMUST00000132718
AA Change: E26G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359
AA Change: E26G

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143172
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185459
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190338
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 89,946,291 (GRCm39) missense probably damaging 1.00
IGL01875:Ctsh APN 9 89,946,260 (GRCm39) missense probably damaging 1.00
IGL02008:Ctsh APN 9 89,943,600 (GRCm39) missense probably damaging 1.00
R0336:Ctsh UTSW 9 89,957,791 (GRCm39) missense probably damaging 1.00
R0632:Ctsh UTSW 9 89,943,635 (GRCm39) missense possibly damaging 0.82
R1488:Ctsh UTSW 9 89,953,944 (GRCm39) missense possibly damaging 0.89
R1847:Ctsh UTSW 9 89,943,618 (GRCm39) missense probably benign 0.04
R3613:Ctsh UTSW 9 89,957,763 (GRCm39) missense probably damaging 1.00
R4270:Ctsh UTSW 9 89,943,651 (GRCm39) missense probably damaging 0.99
R5187:Ctsh UTSW 9 89,936,643 (GRCm39) missense probably damaging 1.00
R5469:Ctsh UTSW 9 89,942,564 (GRCm39) critical splice donor site probably null
R5900:Ctsh UTSW 9 89,946,621 (GRCm39) missense probably damaging 1.00
R5937:Ctsh UTSW 9 89,943,509 (GRCm39) missense probably benign
R6303:Ctsh UTSW 9 89,944,796 (GRCm39) missense possibly damaging 0.83
R6657:Ctsh UTSW 9 89,942,555 (GRCm39) missense probably benign 0.30
R6905:Ctsh UTSW 9 89,944,819 (GRCm39) missense probably damaging 1.00
R6985:Ctsh UTSW 9 89,936,657 (GRCm39) missense possibly damaging 0.90
R7171:Ctsh UTSW 9 89,949,154 (GRCm39) missense probably benign
R7342:Ctsh UTSW 9 89,957,040 (GRCm39) missense probably benign
R7819:Ctsh UTSW 9 89,942,556 (GRCm39) missense possibly damaging 0.71
R7884:Ctsh UTSW 9 89,943,476 (GRCm39) missense probably benign
R8099:Ctsh UTSW 9 89,946,300 (GRCm39) missense probably damaging 1.00
R8294:Ctsh UTSW 9 89,950,489 (GRCm39) missense possibly damaging 0.74
R9195:Ctsh UTSW 9 89,944,815 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTAGCCTTCAGGGTCAGAC -3'
(R):5'- AGGCTTCTGTATCTAGATCTGAGCC -3'

Sequencing Primer
(F):5'- GGTCAGACCCTGAGAACCCTTC -3'
(R):5'- AAGGACTCTAGGTACCTGCCAG -3'
Posted On 2016-03-01