Incidental Mutation 'R4860:Arid5b'
ID372430
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene NameAT rich interactive domain 5B (MRF1-like)
Synonyms5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt
MMRRC Submission 042471-MU
Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location68092520-68278740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68243095 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 137 (N137K)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000219238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020106
AA Change: N137K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947
AA Change: N137K

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218425
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: N137K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 68128975 missense probably damaging 0.96
IGL01731:Arid5b APN 10 68097609 missense probably damaging 1.00
IGL02069:Arid5b APN 10 68097399 missense probably damaging 1.00
IGL02161:Arid5b APN 10 68096668 missense probably benign 0.00
IGL02555:Arid5b APN 10 68101904 missense probably benign 0.01
IGL02873:Arid5b APN 10 68101950 missense probably benign 0.06
IGL03119:Arid5b APN 10 68243227 missense probably damaging 1.00
IGL03271:Arid5b APN 10 68097457 missense possibly damaging 0.73
3-1:Arid5b UTSW 10 68098589 missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 68098011 missense probably damaging 0.99
R0108:Arid5b UTSW 10 68278729 utr 5 prime probably benign
R0525:Arid5b UTSW 10 68097846 missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68186033 missense probably damaging 1.00
R0646:Arid5b UTSW 10 68096977 missense probably damaging 1.00
R1066:Arid5b UTSW 10 68098356 missense probably benign 0.04
R1487:Arid5b UTSW 10 68097214 nonsense probably null
R1638:Arid5b UTSW 10 68277947 missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68186067 missense probably damaging 0.99
R2031:Arid5b UTSW 10 68278688 critical splice donor site probably null
R2337:Arid5b UTSW 10 68097777 missense possibly damaging 0.63
R2996:Arid5b UTSW 10 68098462 missense probably benign 0.01
R2997:Arid5b UTSW 10 68098462 missense probably benign 0.01
R3547:Arid5b UTSW 10 68098462 missense probably benign 0.01
R4411:Arid5b UTSW 10 68096689 missense probably damaging 1.00
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R5219:Arid5b UTSW 10 68278110 missense probably benign 0.08
R5341:Arid5b UTSW 10 68278127 missense possibly damaging 0.87
R5434:Arid5b UTSW 10 68096889 missense possibly damaging 0.67
R5757:Arid5b UTSW 10 68102079 missense probably damaging 1.00
R6114:Arid5b UTSW 10 68097744 missense possibly damaging 0.89
R6313:Arid5b UTSW 10 68097582 missense possibly damaging 0.95
R6338:Arid5b UTSW 10 68098561 nonsense probably null
R6525:Arid5b UTSW 10 68097666 missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68186212 nonsense probably null
R7013:Arid5b UTSW 10 68097819 missense probably damaging 1.00
R7099:Arid5b UTSW 10 68098179 missense probably damaging 1.00
R7260:Arid5b UTSW 10 68097807 missense probably damaging 1.00
R7324:Arid5b UTSW 10 68128922 missense probably benign 0.44
R7334:Arid5b UTSW 10 68243177 missense possibly damaging 0.61
R7432:Arid5b UTSW 10 68118266 missense probably damaging 1.00
R7453:Arid5b UTSW 10 68243164 missense probably benign 0.01
R7649:Arid5b UTSW 10 68118345 missense possibly damaging 0.92
R7659:Arid5b UTSW 10 68098587 missense probably benign
R7661:Arid5b UTSW 10 68098587 missense probably benign
R7662:Arid5b UTSW 10 68098587 missense probably benign
R7663:Arid5b UTSW 10 68098587 missense probably benign
R7665:Arid5b UTSW 10 68098587 missense probably benign
R7666:Arid5b UTSW 10 68098587 missense probably benign
R7759:Arid5b UTSW 10 68097802 missense probably damaging 1.00
R7779:Arid5b UTSW 10 68096776 missense probably damaging 1.00
R7788:Arid5b UTSW 10 68098587 missense probably benign
R7789:Arid5b UTSW 10 68098587 missense probably benign
R7875:Arid5b UTSW 10 68128941 missense probably benign 0.02
R7958:Arid5b UTSW 10 68128941 missense probably benign 0.02
X0066:Arid5b UTSW 10 68118302 missense probably damaging 1.00
Z1177:Arid5b UTSW 10 68097228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGATAGTAAGGGGTTCCAGGATAATG -3'
(R):5'- GCTTGGCTAAGAATGGATCAC -3'

Sequencing Primer
(F):5'- TGGACAGAGTGGATGTAGCTCAC -3'
(R):5'- TCGCTGTCTCTGAAAAGG -3'
Posted On2016-03-01