Incidental Mutation 'R4860:Arhgap45'
ID 372431
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene Name Rho GTPase activating protein 45
Synonyms 6330406L22Rik, Hmha1
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 79852505-79867305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79862900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 692 (V692E)
Ref Sequence ENSEMBL: ENSMUSP00000101012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043311
AA Change: V565E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: V565E

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000099501
AA Change: V681E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: V681E

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105373
AA Change: V692E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: V692E

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150022
Meta Mutation Damage Score 0.1636 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 79,864,482 (GRCm39) splice site probably benign
IGL01414:Arhgap45 APN 10 79,862,938 (GRCm39) missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 79,862,376 (GRCm39) missense probably benign 0.10
IGL02203:Arhgap45 APN 10 79,863,387 (GRCm39) nonsense probably null
IGL02557:Arhgap45 APN 10 79,857,472 (GRCm39) missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 79,853,768 (GRCm39) missense probably benign 0.20
IGL03292:Arhgap45 APN 10 79,856,803 (GRCm39) missense probably benign 0.04
IGL03352:Arhgap45 APN 10 79,866,585 (GRCm39) missense probably damaging 0.96
Celt UTSW 10 79,856,652 (GRCm39) missense probably damaging 1.00
celtic UTSW 10 79,863,423 (GRCm39) nonsense probably null
druid UTSW 10 79,862,181 (GRCm39) critical splice donor site probably null
Mistletoe UTSW 10 79,862,936 (GRCm39) nonsense probably null
Roman UTSW 10 79,863,431 (GRCm39) missense probably damaging 1.00
stonehenge UTSW 10 79,861,316 (GRCm39) missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 79,852,851 (GRCm39) missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 79,856,583 (GRCm39) missense probably benign
R0532:Arhgap45 UTSW 10 79,857,917 (GRCm39) missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 79,863,416 (GRCm39) missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 79,864,811 (GRCm39) missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 79,864,584 (GRCm39) missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 79,864,584 (GRCm39) missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 79,864,929 (GRCm39) missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 79,853,932 (GRCm39) nonsense probably null
R1902:Arhgap45 UTSW 10 79,861,300 (GRCm39) missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 79,856,524 (GRCm39) missense probably benign 0.08
R1935:Arhgap45 UTSW 10 79,866,788 (GRCm39) missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 79,866,788 (GRCm39) missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 79,862,326 (GRCm39) missense probably benign 0.15
R1968:Arhgap45 UTSW 10 79,863,536 (GRCm39) missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 79,856,652 (GRCm39) missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 79,856,530 (GRCm39) missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 79,863,014 (GRCm39) missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 79,863,508 (GRCm39) missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 79,852,813 (GRCm39) start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 79,864,836 (GRCm39) missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 79,864,836 (GRCm39) missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 79,862,281 (GRCm39) missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 79,861,364 (GRCm39) missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 79,862,006 (GRCm39) missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 79,866,127 (GRCm39) missense probably benign 0.00
R4860:Arhgap45 UTSW 10 79,862,900 (GRCm39) missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 79,856,791 (GRCm39) missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 79,862,337 (GRCm39) missense probably benign 0.00
R5102:Arhgap45 UTSW 10 79,857,262 (GRCm39) missense probably benign 0.01
R5128:Arhgap45 UTSW 10 79,866,793 (GRCm39) missense probably benign 0.16
R5667:Arhgap45 UTSW 10 79,861,310 (GRCm39) missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 79,861,310 (GRCm39) missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 79,864,965 (GRCm39) missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 79,866,784 (GRCm39) missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 79,862,068 (GRCm39) missense probably benign 0.25
R6675:Arhgap45 UTSW 10 79,853,938 (GRCm39) missense probably null 0.98
R6738:Arhgap45 UTSW 10 79,863,431 (GRCm39) missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 79,853,698 (GRCm39) missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 79,853,616 (GRCm39) missense probably benign 0.03
R6978:Arhgap45 UTSW 10 79,857,682 (GRCm39) missense probably benign 0.00
R7089:Arhgap45 UTSW 10 79,862,181 (GRCm39) critical splice donor site probably null
R7215:Arhgap45 UTSW 10 79,861,316 (GRCm39) missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 79,865,016 (GRCm39) missense probably benign 0.14
R7308:Arhgap45 UTSW 10 79,862,392 (GRCm39) critical splice donor site probably null
R7480:Arhgap45 UTSW 10 79,862,936 (GRCm39) nonsense probably null
R7481:Arhgap45 UTSW 10 79,858,134 (GRCm39) missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 79,866,835 (GRCm39) missense probably benign 0.00
R7652:Arhgap45 UTSW 10 79,864,672 (GRCm39) missense probably benign 0.01
R7748:Arhgap45 UTSW 10 79,852,766 (GRCm39) unclassified probably benign
R7883:Arhgap45 UTSW 10 79,863,423 (GRCm39) nonsense probably null
R8121:Arhgap45 UTSW 10 79,853,909 (GRCm39) missense probably damaging 0.99
R8169:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8170:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8175:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8178:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8186:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8187:Arhgap45 UTSW 10 79,863,706 (GRCm39) missense probably damaging 1.00
R8687:Arhgap45 UTSW 10 79,852,621 (GRCm39) unclassified probably benign
R8866:Arhgap45 UTSW 10 79,853,750 (GRCm39) missense probably damaging 1.00
R8905:Arhgap45 UTSW 10 79,855,570 (GRCm39) missense probably benign 0.00
R9299:Arhgap45 UTSW 10 79,862,565 (GRCm39) missense possibly damaging 0.82
R9412:Arhgap45 UTSW 10 79,855,564 (GRCm39) start codon destroyed probably null 0.66
R9579:Arhgap45 UTSW 10 79,853,843 (GRCm39) missense probably benign
R9629:Arhgap45 UTSW 10 79,863,694 (GRCm39) missense probably damaging 1.00
R9710:Arhgap45 UTSW 10 79,857,635 (GRCm39) missense probably damaging 0.99
X0023:Arhgap45 UTSW 10 79,866,634 (GRCm39) missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 79,866,190 (GRCm39) missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 79,864,886 (GRCm39) missense probably damaging 0.99
Z1176:Arhgap45 UTSW 10 79,861,370 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGAAGCTGGCTTGGTAG -3'
(R):5'- GCTTTACACTTGCATGACCAGC -3'

Sequencing Primer
(F):5'- AAGCTGGCTTGGTAGCTTCC -3'
(R):5'- GCCTCAGTCCTGATCCGTGATG -3'
Posted On 2016-03-01