Mutagenetix > Incidental Mutation

Incidental Mutation 'R4860:Lrig3'

372433

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

042471-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R4860 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 126011052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 896 (D896E)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000074807
AA Change: D896E

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: D896E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,423	S466P	possibly damaging	Het
1700061G19Rik	A	G	17: 56,888,655	N684S	probably benign	Het
4930435E12Rik	A	G	16: 38,828,145	S201P	probably damaging	Het
Ablim1	T	C	19: 57,079,866	T267A	probably damaging	Het
Acap2	A	T	16: 31,103,499	L724Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Akr1d1	G	A	6: 37,564,491	V308M	probably damaging	Het
Ap1m2	C	T	9: 21,309,674	R54Q	probably benign	Het
Arhgap45	T	A	10: 80,027,066	V692E	probably damaging	Het
Arid5b	G	T	10: 68,243,095	N137K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
BC048679	T	C	7: 81,495,720	N27D	probably benign	Het
Ccdc78	A	G	17: 25,788,700	N237S	probably benign	Het
Cd46	G	A	1: 195,062,396	L345F	possibly damaging	Het
Cngb3	A	T	4: 19,425,569	N459I	possibly damaging	Het
Ctnnd2	A	G	15: 30,881,167	E731G	probably damaging	Het
Ctsh	A	G	9: 90,054,548	E26G	probably benign	Het
Cul1	G	T	6: 47,517,146	K464N	probably benign	Het
Cul1	T	A	6: 47,517,191	S479R	probably damaging	Het
Dcaf5	A	T	12: 80,340,232	D373E	probably benign	Het
Ddx58	G	T	4: 40,210,000	S644R	probably damaging	Het
Dhcr7	A	G	7: 143,840,500	Q126R	probably benign	Het
Dok2	T	C	14: 70,777,516	F228L	probably damaging	Het
Dpep3	T	G	8: 105,976,189	I314L	probably benign	Het
Eps8	A	G	6: 137,514,295	F362L	probably damaging	Het
Espn	G	T	4: 152,138,846	R250S	probably damaging	Het
Faf1	A	C	4: 109,742,896	N163H	probably damaging	Het
Fam198b	C	A	3: 79,936,674	S36*	probably null	Het
Fam71e2	C	T	7: 4,757,469		probably null	Het
Fcho1	C	T	8: 71,710,481	V635I	probably benign	Het
Gm7579	G	A	7: 142,211,908	C17Y	unknown	Het
Gm996	T	C	2: 25,578,753	Y382C	probably damaging	Het
Gpx8	G	T	13: 113,045,508	Y130*	probably null	Het
Gvin1	A	T	7: 106,163,436	Y609N	possibly damaging	Het
Hectd4	T	A	5: 121,305,818	M30K	probably benign	Het
Iqub	T	C	6: 24,450,842	D586G	probably damaging	Het
Klhl25	T	C	7: 75,867,050	I568T	probably benign	Het
Larp6	A	G	9: 60,737,810	E411G	probably damaging	Het
Lepr	A	C	4: 101,789,337	I822L	probably benign	Het
Lrp1	C	T	10: 127,553,824	G3114D	probably damaging	Het
Macf1	A	T	4: 123,486,750	Y1263N	probably damaging	Het
Mapk10	T	C	5: 102,990,619	D180G	probably damaging	Het
Matr3	T	A	18: 35,581,640	V113E	probably damaging	Het
Mbd4	A	T	6: 115,848,926	F368Y	possibly damaging	Het
Mcpt8	G	A	14: 56,082,280	R238W	probably benign	Het
Mcrip2	G	T	17: 25,864,647	T86N	possibly damaging	Het
Mink1	A	G	11: 70,611,592	N1043S	probably damaging	Het
Muc4	G	A	16: 32,754,616	G1497R	probably benign	Het
Muc4	T	A	16: 32,754,625	S1500T	probably benign	Het
Nbeal2	G	A	9: 110,635,194	T1128I	probably benign	Het
Nrg2	T	A	18: 36,196,547	Y205F	probably damaging	Het
Nubp2	A	G	17: 24,884,456	M149T	probably benign	Het
Olfr1062	T	C	2: 86,422,957	T240A	probably damaging	Het
Olfr462	T	A	11: 87,889,225	M224L	probably damaging	Het
Olfr974	G	T	9: 39,942,504	M81I	probably benign	Het
Pax3	A	G	1: 78,192,456	I191T	possibly damaging	Het
Pdcd5	T	C	7: 35,643,710	N137D	possibly damaging	Het
Pik3c2a	G	A	7: 116,340,156	A1649V	probably damaging	Het
Pkhd1l1	T	C	15: 44,537,378	S2183P	possibly damaging	Het
Plekho1	T	A	3: 95,988,993	Q388L	possibly damaging	Het
Ppfibp1	A	G	6: 146,990,514	T91A	probably benign	Het
Ptger4	G	T	15: 5,242,606	N177K	probably benign	Het
Reln	A	G	5: 21,901,751	F3207S	probably benign	Het
Ripk4	C	T	16: 97,751,536	R194H	probably damaging	Het
Rnf112	A	T	11: 61,452,744	C112S	possibly damaging	Het
Rprd1b	T	G	2: 158,074,935	Y278*	probably null	Het
Sel1l	A	G	12: 91,831,602	L140P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc38a3	A	G	9: 107,655,064	V423A	probably damaging	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Slmap	A	T	14: 26,460,209	V323E	probably benign	Het
Smim6	T	C	11: 115,913,504	V39A	probably benign	Het
Sorbs1	T	C	19: 40,337,005	T382A	probably benign	Het
Sparc	G	A	11: 55,399,211	T218I	possibly damaging	Het
Steap1	A	T	5: 5,736,589	F283I	probably damaging	Het
Stil	A	G	4: 115,038,474	T586A	probably benign	Het
Tbce	T	A	13: 14,019,795	D93V	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Tle4	A	T	19: 14,464,345	I435K	probably benign	Het
Tmem245	A	G	4: 56,899,164	F254S	probably damaging	Het
Tmem251	A	T	12: 102,744,055		probably benign	Het
Tubgcp3	T	C	8: 12,649,722	K377R	probably benign	Het
Ush2a	A	T	1: 188,553,275	T2003S	probably benign	Het
Usp53	A	G	3: 122,961,363	S32P	possibly damaging	Het
Vmn1r78	T	A	7: 12,152,756	L98Q	probably damaging	Het
Vmn2r116	A	C	17: 23,401,803	Q837P	probably benign	Het
Vmn2r3	T	C	3: 64,275,601	I226V	probably benign	Het
Vmn2r84	T	A	10: 130,385,843	D836V	probably damaging	Het
Vps13d	A	G	4: 145,087,161	F165L	probably benign	Het
Vstm4	A	G	14: 32,863,785	E103G	possibly damaging	Het
Zfp870	A	T	17: 32,883,340	C339*	probably null	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGGTGAAGCACGGCTATTG -3'
(R):5'- TGTCTGTCCACAGCATCTAGTC -3'

Sequencing Primer
(F):5'- CACGGCTATTGATGGAATGC -3'
(R):5'- GTCCACAGCATCTAGTCTTTAATAC -3'

Posted On

2016-03-01