Incidental Mutation 'R4860:Mink1'
ID 372437
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Name misshapen-like kinase 1 (zebrafish)
Synonyms Misshapen/NIKs-related kinase, Map4k6, Ysk2, MINK
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70453707-70505309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70502418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1043 (N1043S)
Ref Sequence ENSEMBL: ENSMUSP00000072091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000180052] [ENSMUST00000135865] [ENSMUST00000144960]
AlphaFold Q9JM52
Predicted Effect probably benign
Transcript: ENSMUST00000014753
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072237
AA Change: N1043S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: N1043S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
AA Change: N1036S

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: N1036S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
AA Change: N1033S

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: N1033S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102558
AA Change: N999S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: N999S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102559
AA Change: N1007S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: N1007S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect unknown
Transcript: ENSMUST00000136663
AA Change: N896S
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: N896S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153503
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Meta Mutation Damage Score 0.7686 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70,494,638 (GRCm39) missense probably damaging 0.99
IGL00709:Mink1 APN 11 70,503,845 (GRCm39) missense probably damaging 0.99
IGL01064:Mink1 APN 11 70,494,307 (GRCm39) missense probably benign 0.05
IGL02612:Mink1 APN 11 70,488,052 (GRCm39) missense probably damaging 1.00
IGL02797:Mink1 APN 11 70,501,176 (GRCm39) missense probably damaging 1.00
IGL03056:Mink1 APN 11 70,503,409 (GRCm39) critical splice donor site probably null
IGL03066:Mink1 APN 11 70,499,715 (GRCm39) missense probably benign 0.01
IGL03185:Mink1 APN 11 70,494,686 (GRCm39) missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70,489,714 (GRCm39) missense probably benign 0.05
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0025:Mink1 UTSW 11 70,503,868 (GRCm39) missense probably damaging 1.00
R0488:Mink1 UTSW 11 70,488,030 (GRCm39) missense probably damaging 1.00
R0637:Mink1 UTSW 11 70,492,502 (GRCm39) missense probably damaging 0.96
R0828:Mink1 UTSW 11 70,500,971 (GRCm39) nonsense probably null
R1081:Mink1 UTSW 11 70,497,861 (GRCm39) missense probably benign 0.07
R1175:Mink1 UTSW 11 70,502,166 (GRCm39) missense probably benign 0.02
R1441:Mink1 UTSW 11 70,497,940 (GRCm39) missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70,492,833 (GRCm39) missense probably null 1.00
R1545:Mink1 UTSW 11 70,489,717 (GRCm39) missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70,499,706 (GRCm39) missense probably benign 0.00
R1932:Mink1 UTSW 11 70,499,254 (GRCm39) critical splice donor site probably null
R2033:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R2184:Mink1 UTSW 11 70,494,623 (GRCm39) missense probably damaging 1.00
R2267:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2268:Mink1 UTSW 11 70,492,550 (GRCm39) splice site probably null
R2859:Mink1 UTSW 11 70,503,334 (GRCm39) missense probably damaging 1.00
R3713:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70,499,776 (GRCm39) missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R3717:Mink1 UTSW 11 70,498,587 (GRCm39) missense probably damaging 0.98
R4607:Mink1 UTSW 11 70,496,893 (GRCm39) missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70,500,086 (GRCm39) splice site probably null
R4790:Mink1 UTSW 11 70,489,867 (GRCm39) missense probably damaging 0.99
R4847:Mink1 UTSW 11 70,492,854 (GRCm39) missense probably damaging 1.00
R4860:Mink1 UTSW 11 70,502,418 (GRCm39) missense probably damaging 0.98
R5081:Mink1 UTSW 11 70,495,970 (GRCm39) missense probably damaging 0.98
R5310:Mink1 UTSW 11 70,498,169 (GRCm39) missense probably benign 0.33
R5677:Mink1 UTSW 11 70,495,991 (GRCm39) missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70,496,901 (GRCm39) missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70,498,616 (GRCm39) missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70,500,885 (GRCm39) unclassified probably benign
R5950:Mink1 UTSW 11 70,500,412 (GRCm39) missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70,489,915 (GRCm39) missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6034:Mink1 UTSW 11 70,497,866 (GRCm39) small deletion probably benign
R6058:Mink1 UTSW 11 70,502,546 (GRCm39) missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70,501,478 (GRCm39) missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70,500,927 (GRCm39) missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70,489,720 (GRCm39) missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70,494,151 (GRCm39) splice site probably null
R6269:Mink1 UTSW 11 70,489,813 (GRCm39) missense probably damaging 1.00
R6273:Mink1 UTSW 11 70,502,261 (GRCm39) nonsense probably null
R6301:Mink1 UTSW 11 70,503,120 (GRCm39) missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70,500,419 (GRCm39) missense probably damaging 0.96
R6876:Mink1 UTSW 11 70,498,261 (GRCm39) missense probably benign 0.02
R7030:Mink1 UTSW 11 70,498,601 (GRCm39) missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70,503,158 (GRCm39) missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70,500,901 (GRCm39) splice site probably null
R7135:Mink1 UTSW 11 70,494,329 (GRCm39) missense probably damaging 1.00
R7238:Mink1 UTSW 11 70,502,305 (GRCm39) critical splice donor site probably null
R7320:Mink1 UTSW 11 70,489,899 (GRCm39) missense probably benign 0.23
R7396:Mink1 UTSW 11 70,495,994 (GRCm39) missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70,500,455 (GRCm39) missense probably benign 0.18
R7723:Mink1 UTSW 11 70,503,736 (GRCm39) missense probably benign 0.16
R7896:Mink1 UTSW 11 70,503,108 (GRCm39) missense possibly damaging 0.71
R8058:Mink1 UTSW 11 70,494,594 (GRCm39) nonsense probably null
R8082:Mink1 UTSW 11 70,504,103 (GRCm39) missense possibly damaging 0.71
R8160:Mink1 UTSW 11 70,496,907 (GRCm39) nonsense probably null
R8335:Mink1 UTSW 11 70,500,401 (GRCm39) missense probably damaging 0.97
R8353:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8453:Mink1 UTSW 11 70,501,154 (GRCm39) missense possibly damaging 0.70
R8732:Mink1 UTSW 11 70,500,902 (GRCm39) critical splice acceptor site probably null
R9072:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9073:Mink1 UTSW 11 70,499,207 (GRCm39) missense possibly damaging 0.86
R9324:Mink1 UTSW 11 70,502,477 (GRCm39) missense probably damaging 0.98
R9596:Mink1 UTSW 11 70,497,915 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGTGGTCAACGTCAATCC -3'
(R):5'- AGCAATTAAGCCCCTTGTCC -3'

Sequencing Primer
(F):5'- CGAGCTCATAGTGAAACTCCTG -3'
(R):5'- TTAAGCCCCTTGTCCCCAAAC -3'
Posted On 2016-03-01