Incidental Mutation 'R4860:Tbce'
ID372444
Institutional Source Beutler Lab
Gene Symbol Tbce
Ensembl Gene ENSMUSG00000039233
Gene Nametubulin-specific chaperone E
Synonyms
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location13997949-14039638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14019795 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000125613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039894] [ENSMUST00000159893] [ENSMUST00000162326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039894
AA Change: D93V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047880
Gene: ENSMUSG00000039233
AA Change: D93V

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-20 SMART
low complexity region 347 360 N/A INTRINSIC
Pfam:Ubiquitin_2 442 523 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159239
Predicted Effect unknown
Transcript: ENSMUST00000159893
AA Change: M65L
SMART Domains Protein: ENSMUSP00000125244
Gene: ENSMUSG00000039233
AA Change: M65L

DomainStartEndE-ValueType
SCOP:d1lpla_ 9 35 3e-5 SMART
Blast:CAP_GLY 10 34 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160776
Predicted Effect probably damaging
Transcript: ENSMUST00000162326
AA Change: D93V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125613
Gene: ENSMUSG00000039233
AA Change: D93V

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-21 SMART
low complexity region 347 360 N/A INTRINSIC
Meta Mutation Damage Score 0.1864 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a tubulin binding cofactor that participates in microtubule dynamics. A mouse model of progressive motor neuropathy (pmn) was discovered to harbor a single amino acid deletion in this gene. Mice that are homozygous for pmn allele exhibit progressive atrophy and premature death due to respiratory failure. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive caudal-cranial motor neuron degeneration, beginning around 3 weeks and culminating in death due to respiratory paralysis by 7 weeks. The sciatic and phrenic nerves are especially affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Matr3 T A 18: 35,581,640 V113E probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Tbce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Tbce APN 13 14009740 splice site probably benign
IGL01405:Tbce APN 13 14003695 missense probably damaging 1.00
IGL03142:Tbce APN 13 14019864 missense possibly damaging 0.90
R0362:Tbce UTSW 13 13998162 missense probably benign 0.12
R1736:Tbce UTSW 13 14009642 missense possibly damaging 0.64
R1845:Tbce UTSW 13 14019709 missense probably benign 0.22
R4445:Tbce UTSW 13 13998395 missense possibly damaging 0.82
R4803:Tbce UTSW 13 14019861 missense probably damaging 1.00
R4860:Tbce UTSW 13 14019795 missense probably damaging 0.97
R4862:Tbce UTSW 13 13998419 missense possibly damaging 0.94
R5096:Tbce UTSW 13 14029405 splice site probably benign
R5391:Tbce UTSW 13 14005965 missense probably damaging 0.99
R6050:Tbce UTSW 13 13998434 missense possibly damaging 0.82
R6179:Tbce UTSW 13 14019777 missense probably benign
R6645:Tbce UTSW 13 14005229 missense probably benign 0.04
R7062:Tbce UTSW 13 14019795 missense possibly damaging 0.89
R7222:Tbce UTSW 13 13998150 missense probably damaging 1.00
R7572:Tbce UTSW 13 14010587 missense probably benign
R7587:Tbce UTSW 13 14019742 missense probably damaging 1.00
R7726:Tbce UTSW 13 14029290 missense probably damaging 1.00
R7747:Tbce UTSW 13 14006478 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTCCACATTTTAAGCCACTAAGG -3'
(R):5'- AGAGCCTTGTCAGGTCTGAAG -3'

Sequencing Primer
(F):5'- TTTTAAGCCACTAAGGAAAGAAGGTG -3'
(R):5'- CTTGTCAGGTCTGAAGCCTGC -3'
Posted On2016-03-01