Incidental Mutation 'R4860:Muc4'
ID 372458
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Name mucin 4
Synonyms 4933405I11Rik
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4860 (G1)
Quality Score 97
Status Not validated
Chromosome 16
Chromosomal Location 32555089-32602761 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32754625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1500 (S1500T)
Ref Sequence ENSEMBL: ENSMUSP00000093813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000096106
AA Change: S1500T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: S1500T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132475
SMART Domains Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 38 45 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 99 127 N/A INTRINSIC
low complexity region 148 173 N/A INTRINSIC
low complexity region 192 224 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135753
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Matr3 T A 18: 35,714,693 (GRCm39) V113E probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00088:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00089:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00090:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00091:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00092:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00163:Muc4 APN 16 32,754,090 (GRCm38) missense probably benign 0.20
IGL00324:Muc4 APN 16 32,599,186 (GRCm39) missense probably benign 0.03
IGL00331:Muc4 APN 16 32,574,613 (GRCm39) missense probably benign 0.01
IGL00539:Muc4 APN 16 32,569,728 (GRCm39) missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32,575,465 (GRCm39) missense probably benign 0.10
IGL00990:Muc4 APN 16 32,753,886 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,753,863 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,752,569 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,140 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,139 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,114 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,576,179 (GRCm39) unclassified probably benign
IGL00990:Muc4 APN 16 32,575,246 (GRCm39) missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32,575,362 (GRCm39) missense probably benign 0.01
IGL01091:Muc4 APN 16 32,753,927 (GRCm38) missense probably benign 0.04
IGL01124:Muc4 APN 16 32,589,104 (GRCm39) missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32,753,901 (GRCm38) missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32,584,340 (GRCm39) missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32,569,473 (GRCm39) missense probably benign 0.23
IGL01618:Muc4 APN 16 32,577,001 (GRCm39) missense unknown
IGL01625:Muc4 APN 16 32,575,918 (GRCm39) unclassified probably benign
IGL01626:Muc4 APN 16 32,555,220 (GRCm39) missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32,581,722 (GRCm39) splice site probably null
IGL01682:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL01870:Muc4 APN 16 32,574,624 (GRCm39) missense probably benign 0.01
IGL01966:Muc4 APN 16 32,570,244 (GRCm39) missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32,575,383 (GRCm39) missense probably benign 0.01
IGL02089:Muc4 APN 16 32,570,131 (GRCm39) missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32,598,023 (GRCm39) splice site probably benign
IGL02210:Muc4 APN 16 32,574,054 (GRCm39) missense probably benign 0.00
IGL02278:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02280:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02316:Muc4 APN 16 32,569,668 (GRCm39) missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32,570,894 (GRCm39) missense probably benign 0.41
IGL02449:Muc4 APN 16 32,576,503 (GRCm39) unclassified probably benign
IGL02607:Muc4 APN 16 32,596,193 (GRCm39) missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32,575,656 (GRCm39) unclassified probably benign
IGL02893:Muc4 APN 16 32,570,466 (GRCm39) missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32,569,212 (GRCm39) missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32,570,866 (GRCm39) missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32,570,766 (GRCm39) missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32,570,257 (GRCm39) nonsense probably null
IGL03335:Muc4 APN 16 32,574,449 (GRCm39) missense probably benign 0.01
IGL03411:Muc4 APN 16 32,575,436 (GRCm39) missense probably benign 0.01
multisplendored UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
protean UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R0864_muc4_269 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
3-1:Muc4 UTSW 16 32,590,768 (GRCm39) missense possibly damaging 0.86
3-1:Muc4 UTSW 16 32,580,625 (GRCm39) splice site probably benign
BB004:Muc4 UTSW 16 32,592,011 (GRCm39) missense
BB014:Muc4 UTSW 16 32,592,011 (GRCm39) missense
IGL02835:Muc4 UTSW 16 32,584,319 (GRCm39) missense probably benign 0.32
P0035:Muc4 UTSW 16 32,580,622 (GRCm39) splice site probably benign
PIT4131001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,699 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4366001:Muc4 UTSW 16 32,575,542 (GRCm39) missense unknown
PIT4531001:Muc4 UTSW 16 32,576,391 (GRCm39) missense unknown
R0119:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32,591,978 (GRCm39) missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32,586,120 (GRCm39) missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0299:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32,574,333 (GRCm39) missense probably benign 0.00
R0462:Muc4 UTSW 16 32,582,910 (GRCm39) missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32,569,887 (GRCm39) missense probably benign 0.01
R0508:Muc4 UTSW 16 32,570,131 (GRCm39) missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32,577,120 (GRCm39) missense unknown
R0578:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0617:Muc4 UTSW 16 32,570,925 (GRCm39) missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32,570,488 (GRCm39) missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32,590,201 (GRCm39) missense probably damaging 0.99
R0727:Muc4 UTSW 16 32,590,221 (GRCm39) missense probably benign 0.01
R0776:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R0854:Muc4 UTSW 16 32,599,329 (GRCm39) missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0864:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0926:Muc4 UTSW 16 32,576,570 (GRCm39) unclassified probably benign
R0990:Muc4 UTSW 16 32,752,722 (GRCm38) missense probably benign 0.00
R1127:Muc4 UTSW 16 32,569,343 (GRCm39) missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R1433:Muc4 UTSW 16 32,574,448 (GRCm39) missense probably benign 0.00
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1506:Muc4 UTSW 16 32,574,033 (GRCm39) missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32,569,167 (GRCm39) missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1584:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1593:Muc4 UTSW 16 32,754,686 (GRCm38) missense probably benign 0.00
R1601:Muc4 UTSW 16 32,575,875 (GRCm39) unclassified probably benign
R1611:Muc4 UTSW 16 32,569,804 (GRCm39) missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32,577,276 (GRCm39) missense probably benign 0.11
R1717:Muc4 UTSW 16 32,753,405 (GRCm38) missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1824:Muc4 UTSW 16 32,576,307 (GRCm39) unclassified probably benign
R1839:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1846:Muc4 UTSW 16 32,752,369 (GRCm38) missense probably benign 0.01
R1864:Muc4 UTSW 16 32,576,625 (GRCm39) unclassified probably benign
R1868:Muc4 UTSW 16 32,576,715 (GRCm39) missense unknown
R1928:Muc4 UTSW 16 32,569,350 (GRCm39) missense probably damaging 0.99
R1942:Muc4 UTSW 16 32,569,460 (GRCm39) missense probably damaging 0.99
R2017:Muc4 UTSW 16 32,570,121 (GRCm39) missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32,574,054 (GRCm39) missense probably benign 0.00
R2081:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R2088:Muc4 UTSW 16 32,576,783 (GRCm39) missense unknown
R2121:Muc4 UTSW 16 32,580,612 (GRCm39) missense unknown
R2139:Muc4 UTSW 16 32,581,599 (GRCm39) missense unknown
R2158:Muc4 UTSW 16 32,754,563 (GRCm38) missense probably benign 0.10
R2165:Muc4 UTSW 16 32,569,294 (GRCm39) missense probably damaging 0.96
R2210:Muc4 UTSW 16 32,755,176 (GRCm38) frame shift probably null
R2225:Muc4 UTSW 16 32,587,316 (GRCm39) missense possibly damaging 0.73
R2225:Muc4 UTSW 16 32,576,265 (GRCm39) unclassified probably benign
R2269:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R2679:Muc4 UTSW 16 32,577,846 (GRCm39) missense unknown
R3703:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R3816:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R3909:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4014:Muc4 UTSW 16 32,575,647 (GRCm39) unclassified probably benign
R4065:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4249:Muc4 UTSW 16 32,576,200 (GRCm39) unclassified probably benign
R4344:Muc4 UTSW 16 32,590,666 (GRCm39) missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4393:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R4482:Muc4 UTSW 16 32,577,075 (GRCm39) missense unknown
R4523:Muc4 UTSW 16 32,555,154 (GRCm39) utr 5 prime probably benign
R4527:Muc4 UTSW 16 32,576,217 (GRCm39) unclassified probably benign
R4572:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4587:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4614:Muc4 UTSW 16 32,577,432 (GRCm39) missense probably benign 0.03
R4635:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4661:Muc4 UTSW 16 32,589,651 (GRCm39) missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32,576,220 (GRCm39) unclassified probably benign
R4730:Muc4 UTSW 16 32,570,032 (GRCm39) missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32,596,277 (GRCm39) missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32,574,916 (GRCm39) unclassified probably benign
R4818:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4821:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4825:Muc4 UTSW 16 32,570,565 (GRCm39) missense probably benign 0.41
R4830:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4860:Muc4 UTSW 16 32,754,616 (GRCm38) missense probably benign 0.35
R4869:Muc4 UTSW 16 32,754,836 (GRCm38) unclassified probably benign
R4934:Muc4 UTSW 16 32,576,472 (GRCm39) unclassified probably benign
R4959:Muc4 UTSW 16 32,575,437 (GRCm39) missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32,754,572 (GRCm38) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,575,332 (GRCm39) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,754,214 (GRCm38) missense probably benign 0.01
R4999:Muc4 UTSW 16 32,576,670 (GRCm39) unclassified probably benign
R5073:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R5075:Muc4 UTSW 16 32,754,794 (GRCm38) unclassified probably benign
R5152:Muc4 UTSW 16 32,577,432 (GRCm39) nonsense probably null
R5161:Muc4 UTSW 16 32,582,895 (GRCm39) missense probably damaging 0.98
R5174:Muc4 UTSW 16 32,570,556 (GRCm39) missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32,570,484 (GRCm39) missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R5474:Muc4 UTSW 16 32,581,635 (GRCm39) missense unknown
R5567:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32,754,253 (GRCm38) missense probably benign 0.01
R5665:Muc4 UTSW 16 32,569,600 (GRCm39) missense probably benign 0.33
R5667:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5671:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5693:Muc4 UTSW 16 32,597,181 (GRCm39) missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32,555,059 (GRCm39) nonsense probably null
R5708:Muc4 UTSW 16 32,575,515 (GRCm39) unclassified probably benign
R5715:Muc4 UTSW 16 32,570,734 (GRCm39) missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32,595,213 (GRCm39) missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32,570,113 (GRCm39) missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32,570,523 (GRCm39) missense probably benign 0.41
R5933:Muc4 UTSW 16 32,574,480 (GRCm39) missense probably benign 0.01
R5966:Muc4 UTSW 16 32,576,652 (GRCm39) unclassified probably benign
R6062:Muc4 UTSW 16 32,579,682 (GRCm39) missense unknown
R6067:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R6067:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6078:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6079:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6112:Muc4 UTSW 16 32,596,157 (GRCm39) missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32,577,169 (GRCm39) missense unknown
R6144:Muc4 UTSW 16 32,587,298 (GRCm39) missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R6173:Muc4 UTSW 16 32,554,958 (GRCm39) start gained probably benign
R6268:Muc4 UTSW 16 32,589,141 (GRCm39) missense probably damaging 0.99
R6299:Muc4 UTSW 16 32,570,853 (GRCm39) missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32,575,237 (GRCm39) missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32,575,476 (GRCm39) missense probably benign 0.19
R6361:Muc4 UTSW 16 32,587,725 (GRCm39) missense probably benign 0.32
R6375:Muc4 UTSW 16 32,555,061 (GRCm39) utr 5 prime probably benign
R6378:Muc4 UTSW 16 32,599,320 (GRCm39) missense probably benign 0.33
R6418:Muc4 UTSW 16 32,570,607 (GRCm39) missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32,579,694 (GRCm39) critical splice donor site probably null
R6527:Muc4 UTSW 16 32,753,433 (GRCm38) missense probably benign 0.01
R6616:Muc4 UTSW 16 32,602,378 (GRCm39) missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6637:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6915:Muc4 UTSW 16 32,587,312 (GRCm39) missense probably benign 0.18
R6947:Muc4 UTSW 16 32,596,177 (GRCm39) missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32,582,892 (GRCm39) missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32,570,817 (GRCm39) missense probably benign 0.00
R7020:Muc4 UTSW 16 32,570,628 (GRCm39) nonsense probably null
R7033:Muc4 UTSW 16 32,576,698 (GRCm39) unclassified probably benign
R7098:Muc4 UTSW 16 32,577,465 (GRCm39) missense
R7123:Muc4 UTSW 16 32,569,509 (GRCm39) missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32,582,862 (GRCm39) missense probably damaging 0.97
R7178:Muc4 UTSW 16 32,752,788 (GRCm38) missense unknown
R7294:Muc4 UTSW 16 32,576,835 (GRCm39) missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32,575,710 (GRCm39) missense unknown
R7361:Muc4 UTSW 16 32,754,670 (GRCm38) missense probably benign 0.18
R7380:Muc4 UTSW 16 32,575,740 (GRCm39) missense unknown
R7381:Muc4 UTSW 16 32,601,285 (GRCm39) missense
R7411:Muc4 UTSW 16 32,570,140 (GRCm39) missense probably benign 0.12
R7422:Muc4 UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R7482:Muc4 UTSW 16 32,587,324 (GRCm39) missense
R7539:Muc4 UTSW 16 32,576,770 (GRCm39) missense
R7544:Muc4 UTSW 16 32,555,016 (GRCm39) start codon destroyed probably null
R7574:Muc4 UTSW 16 32,753,411 (GRCm38) missense probably benign 0.18
R7576:Muc4 UTSW 16 32,754,500 (GRCm38) missense probably benign 0.10
R7585:Muc4 UTSW 16 32,586,076 (GRCm39) missense
R7596:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7597:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7602:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7616:Muc4 UTSW 16 32,574,161 (GRCm39) nonsense probably null
R7639:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7640:Muc4 UTSW 16 32,580,479 (GRCm39) missense
R7651:Muc4 UTSW 16 32,576,949 (GRCm39) missense
R7688:Muc4 UTSW 16 32,570,278 (GRCm39) missense possibly damaging 0.68
R7689:Muc4 UTSW 16 32,574,439 (GRCm39) missense probably benign 0.10
R7752:Muc4 UTSW 16 32,589,108 (GRCm39) missense
R7763:Muc4 UTSW 16 32,574,739 (GRCm39) missense probably benign 0.10
R7768:Muc4 UTSW 16 32,576,568 (GRCm39) missense unknown
R7787:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7789:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7838:Muc4 UTSW 16 32,752,558 (GRCm38) nonsense probably null
R7871:Muc4 UTSW 16 32,754,935 (GRCm38) missense unknown
R7921:Muc4 UTSW 16 32,570,139 (GRCm39) missense possibly damaging 0.68
R7927:Muc4 UTSW 16 32,592,011 (GRCm39) missense
R7930:Muc4 UTSW 16 32,575,369 (GRCm39) unclassified probably benign
R8000:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8062:Muc4 UTSW 16 32,577,123 (GRCm39) missense
R8096:Muc4 UTSW 16 32,575,764 (GRCm39) missense unknown
R8115:Muc4 UTSW 16 32,575,678 (GRCm39) missense unknown
R8162:Muc4 UTSW 16 32,569,197 (GRCm39) missense unknown
R8220:Muc4 UTSW 16 32,575,701 (GRCm39) missense unknown
R8260:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8290:Muc4 UTSW 16 32,575,434 (GRCm39) missense probably benign 0.01
R8299:Muc4 UTSW 16 32,576,271 (GRCm39) missense unknown
R8313:Muc4 UTSW 16 32,753,423 (GRCm38) missense probably benign 0.04
R8356:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8463:Muc4 UTSW 16 32,574,201 (GRCm39) missense probably benign 0.00
R8479:Muc4 UTSW 16 32,574,799 (GRCm39) missense possibly damaging 0.59
R8480:Muc4 UTSW 16 32,574,421 (GRCm39) missense probably benign 0.20
R8510:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8515:Muc4 UTSW 16 32,575,629 (GRCm39) missense unknown
R8559:Muc4 UTSW 16 32,754,715 (GRCm38) missense unknown
R8685:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8687:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8728:Muc4 UTSW 16 32,754,952 (GRCm38) missense unknown
R8754:Muc4 UTSW 16 32,602,356 (GRCm39) missense
R8845:Muc4 UTSW 16 32,576,889 (GRCm39) missense possibly damaging 0.86
R8852:Muc4 UTSW 16 32,569,461 (GRCm39) missense possibly damaging 0.66
R8863:Muc4 UTSW 16 32,570,280 (GRCm39) missense possibly damaging 0.84
R8896:Muc4 UTSW 16 32,754,673 (GRCm38) missense probably benign 0.01
R8929:Muc4 UTSW 16 32,575,285 (GRCm39) missense probably benign 0.00
R8929:Muc4 UTSW 16 32,754,017 (GRCm38) missense possibly damaging 0.53
R8990:Muc4 UTSW 16 32,574,009 (GRCm39) missense probably benign 0.01
R9018:Muc4 UTSW 16 32,582,910 (GRCm39) missense
R9034:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9064:Muc4 UTSW 16 32,754,397 (GRCm38) missense possibly damaging 0.53
R9068:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9086:Muc4 UTSW 16 32,577,842 (GRCm39) missense
R9151:Muc4 UTSW 16 32,752,617 (GRCm38) missense probably benign 0.01
R9187:Muc4 UTSW 16 32,589,102 (GRCm39) missense
R9336:Muc4 UTSW 16 32,569,756 (GRCm39) missense possibly damaging 0.86
R9343:Muc4 UTSW 16 32,569,971 (GRCm39) missense possibly damaging 0.53
R9363:Muc4 UTSW 16 32,576,992 (GRCm39) missense
R9429:Muc4 UTSW 16 32,576,098 (GRCm39) missense unknown
R9570:Muc4 UTSW 16 32,569,695 (GRCm39) missense possibly damaging 0.53
R9609:Muc4 UTSW 16 32,577,234 (GRCm39) missense
R9696:Muc4 UTSW 16 32,574,712 (GRCm39) missense probably benign 0.00
R9709:Muc4 UTSW 16 32,590,644 (GRCm39) missense
R9743:Muc4 UTSW 16 32,601,194 (GRCm39) missense
R9747:Muc4 UTSW 16 32,754,698 (GRCm38) missense probably benign 0.01
RF014:Muc4 UTSW 16 32,570,676 (GRCm39) missense probably damaging 0.98
U15987:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
U15987:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
V5622:Muc4 UTSW 16 32,570,643 (GRCm39) missense probably benign 0.00
X0018:Muc4 UTSW 16 32,575,855 (GRCm39) unclassified probably benign
X0028:Muc4 UTSW 16 32,579,693 (GRCm39) critical splice donor site probably null
Z1088:Muc4 UTSW 16 32,576,450 (GRCm39) unclassified probably benign
Z1176:Muc4 UTSW 16 32,589,104 (GRCm39) missense possibly damaging 0.65
Z1177:Muc4 UTSW 16 32,587,767 (GRCm39) nonsense probably null
Z1177:Muc4 UTSW 16 32,595,236 (GRCm39) missense
Z1177:Muc4 UTSW 16 32,587,768 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCAGAGGTGACCACATCAAC -3'
(R):5'- TCTGAATTTGGTCACGGGAG -3'

Sequencing Primer
(F):5'- GGTGACCACATCAACTCCTTCAG -3'
(R):5'- ATTTGGTCACGGGAGGAGGC -3'
Posted On 2016-03-01