Incidental Mutation 'R4860:Matr3'
ID372467
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Namematrin 3
Synonyms2810017I02Rik, D030046F20Rik, 1110061A14Rik
MMRRC Submission 042471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4860 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35562146-35593835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35581640 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 113 (V113E)
Ref Sequence ENSEMBL: ENSMUSP00000141135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187793] [ENSMUST00000188275] [ENSMUST00000188767] [ENSMUST00000189039] [ENSMUST00000189163] [ENSMUST00000190029] [ENSMUST00000190121] [ENSMUST00000190653]
Predicted Effect probably damaging
Transcript: ENSMUST00000166793
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186158
Predicted Effect probably benign
Transcript: ENSMUST00000186614
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186796
AA Change: V113E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187389
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000188275
AA Change: V163E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236
AA Change: V163E

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189019
Predicted Effect probably benign
Transcript: ENSMUST00000189039
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect probably damaging
Transcript: ENSMUST00000190029
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190121
AA Change: V113E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190653
AA Change: V113E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193225
Meta Mutation Damage Score 0.9605 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 72,455,423 S466P possibly damaging Het
1700061G19Rik A G 17: 56,888,655 N684S probably benign Het
4930435E12Rik A G 16: 38,828,145 S201P probably damaging Het
Ablim1 T C 19: 57,079,866 T267A probably damaging Het
Acap2 A T 16: 31,103,499 L724Q possibly damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agrp T C 8: 105,567,368 E41G probably benign Het
Akr1d1 G A 6: 37,564,491 V308M probably damaging Het
Ap1m2 C T 9: 21,309,674 R54Q probably benign Het
Arhgap45 T A 10: 80,027,066 V692E probably damaging Het
Arid5b G T 10: 68,243,095 N137K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
BC048679 T C 7: 81,495,720 N27D probably benign Het
Ccdc78 A G 17: 25,788,700 N237S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,167 E731G probably damaging Het
Ctsh A G 9: 90,054,548 E26G probably benign Het
Cul1 G T 6: 47,517,146 K464N probably benign Het
Cul1 T A 6: 47,517,191 S479R probably damaging Het
Dcaf5 A T 12: 80,340,232 D373E probably benign Het
Ddx58 G T 4: 40,210,000 S644R probably damaging Het
Dhcr7 A G 7: 143,840,500 Q126R probably benign Het
Dok2 T C 14: 70,777,516 F228L probably damaging Het
Dpep3 T G 8: 105,976,189 I314L probably benign Het
Eps8 A G 6: 137,514,295 F362L probably damaging Het
Espn G T 4: 152,138,846 R250S probably damaging Het
Faf1 A C 4: 109,742,896 N163H probably damaging Het
Fam198b C A 3: 79,936,674 S36* probably null Het
Fam71e2 C T 7: 4,757,469 probably null Het
Fcho1 C T 8: 71,710,481 V635I probably benign Het
Gm7579 G A 7: 142,211,908 C17Y unknown Het
Gm996 T C 2: 25,578,753 Y382C probably damaging Het
Gpx8 G T 13: 113,045,508 Y130* probably null Het
Gvin1 A T 7: 106,163,436 Y609N possibly damaging Het
Hectd4 T A 5: 121,305,818 M30K probably benign Het
Iqub T C 6: 24,450,842 D586G probably damaging Het
Klhl25 T C 7: 75,867,050 I568T probably benign Het
Larp6 A G 9: 60,737,810 E411G probably damaging Het
Lepr A C 4: 101,789,337 I822L probably benign Het
Lrig3 C A 10: 126,011,052 D896E probably benign Het
Lrp1 C T 10: 127,553,824 G3114D probably damaging Het
Macf1 A T 4: 123,486,750 Y1263N probably damaging Het
Mapk10 T C 5: 102,990,619 D180G probably damaging Het
Mbd4 A T 6: 115,848,926 F368Y possibly damaging Het
Mcpt8 G A 14: 56,082,280 R238W probably benign Het
Mcrip2 G T 17: 25,864,647 T86N possibly damaging Het
Mink1 A G 11: 70,611,592 N1043S probably damaging Het
Muc4 G A 16: 32,754,616 G1497R probably benign Het
Muc4 T A 16: 32,754,625 S1500T probably benign Het
Nbeal2 G A 9: 110,635,194 T1128I probably benign Het
Nrg2 T A 18: 36,196,547 Y205F probably damaging Het
Nubp2 A G 17: 24,884,456 M149T probably benign Het
Olfr1062 T C 2: 86,422,957 T240A probably damaging Het
Olfr462 T A 11: 87,889,225 M224L probably damaging Het
Olfr974 G T 9: 39,942,504 M81I probably benign Het
Pax3 A G 1: 78,192,456 I191T possibly damaging Het
Pdcd5 T C 7: 35,643,710 N137D possibly damaging Het
Pik3c2a G A 7: 116,340,156 A1649V probably damaging Het
Pkhd1l1 T C 15: 44,537,378 S2183P possibly damaging Het
Plekho1 T A 3: 95,988,993 Q388L possibly damaging Het
Ppfibp1 A G 6: 146,990,514 T91A probably benign Het
Ptger4 G T 15: 5,242,606 N177K probably benign Het
Reln A G 5: 21,901,751 F3207S probably benign Het
Ripk4 C T 16: 97,751,536 R194H probably damaging Het
Rnf112 A T 11: 61,452,744 C112S possibly damaging Het
Rprd1b T G 2: 158,074,935 Y278* probably null Het
Sel1l A G 12: 91,831,602 L140P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a3 A G 9: 107,655,064 V423A probably damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Slmap A T 14: 26,460,209 V323E probably benign Het
Smim6 T C 11: 115,913,504 V39A probably benign Het
Sorbs1 T C 19: 40,337,005 T382A probably benign Het
Sparc G A 11: 55,399,211 T218I possibly damaging Het
Steap1 A T 5: 5,736,589 F283I probably damaging Het
Stil A G 4: 115,038,474 T586A probably benign Het
Tbce T A 13: 14,019,795 D93V probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Tle4 A T 19: 14,464,345 I435K probably benign Het
Tmem245 A G 4: 56,899,164 F254S probably damaging Het
Tmem251 A T 12: 102,744,055 probably benign Het
Tubgcp3 T C 8: 12,649,722 K377R probably benign Het
Ush2a A T 1: 188,553,275 T2003S probably benign Het
Usp53 A G 3: 122,961,363 S32P possibly damaging Het
Vmn1r78 T A 7: 12,152,756 L98Q probably damaging Het
Vmn2r116 A C 17: 23,401,803 Q837P probably benign Het
Vmn2r3 T C 3: 64,275,601 I226V probably benign Het
Vmn2r84 T A 10: 130,385,843 D836V probably damaging Het
Vps13d A G 4: 145,087,161 F165L probably benign Het
Vstm4 A G 14: 32,863,785 E103G possibly damaging Het
Zfp870 A T 17: 32,883,340 C339* probably null Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35588389 missense probably damaging 1.00
IGL03083:Matr3 APN 18 35572418 missense probably damaging 0.96
IGL03117:Matr3 APN 18 35572657 missense probably damaging 1.00
IGL03163:Matr3 APN 18 35572591 missense probably damaging 0.99
IGL03381:Matr3 APN 18 35579025 splice site probably benign
R0456:Matr3 UTSW 18 35572864 missense probably damaging 1.00
R1136:Matr3 UTSW 18 35572895 missense probably damaging 1.00
R1459:Matr3 UTSW 18 35584656 missense probably benign 0.28
R1850:Matr3 UTSW 18 35582057 missense probably damaging 1.00
R1929:Matr3 UTSW 18 35588325 splice site probably benign
R2185:Matr3 UTSW 18 35581225 missense probably damaging 1.00
R2366:Matr3 UTSW 18 35588395 missense probably damaging 1.00
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2873:Matr3 UTSW 18 35572296 missense probably benign 0.25
R3908:Matr3 UTSW 18 35572841 missense probably damaging 1.00
R4400:Matr3 UTSW 18 35583916 missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35572118 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4881:Matr3 UTSW 18 35572375 missense probably damaging 1.00
R4908:Matr3 UTSW 18 35572701 missense probably damaging 0.96
R5084:Matr3 UTSW 18 35582082 missense probably damaging 0.99
R5660:Matr3 UTSW 18 35572094 missense probably damaging 0.99
R5709:Matr3 UTSW 18 35581962 missense probably damaging 1.00
R5779:Matr3 UTSW 18 35584522 missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35587738 missense probably benign
R6392:Matr3 UTSW 18 35584841 missense probably benign 0.07
R7062:Matr3 UTSW 18 35579019 critical splice donor site probably null
R7156:Matr3 UTSW 18 35572921 missense probably damaging 0.98
R7228:Matr3 UTSW 18 35562484 missense unknown
R7389:Matr3 UTSW 18 35584585 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGCTTGAACACTGTGGTC -3'
(R):5'- ACGACCAAGTTCTTGCTTTTG -3'

Sequencing Primer
(F):5'- CAGCTTGAACACTGTGGTCTTTTG -3'
(R):5'- GACCAAGTTCTTGCTTTTGATCAAAC -3'
Posted On2016-03-01