Incidental Mutation 'R4860:Matr3'
ID 372467
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Name matrin 3
Synonyms D030046F20Rik, 2810017I02Rik, 1110061A14Rik
MMRRC Submission 042471-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R4860 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 35695191-35726888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35714693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 113 (V113E)
Ref Sequence ENSEMBL: ENSMUSP00000141135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187793] [ENSMUST00000190029] [ENSMUST00000190653] [ENSMUST00000190121] [ENSMUST00000188275] [ENSMUST00000189163] [ENSMUST00000188767] [ENSMUST00000189039]
AlphaFold Q8K310
Predicted Effect probably damaging
Transcript: ENSMUST00000166793
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186158
Predicted Effect probably benign
Transcript: ENSMUST00000186614
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186796
AA Change: V113E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187389
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190029
AA Change: V451E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: V451E

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190653
AA Change: V113E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190121
AA Change: V113E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188275
AA Change: V163E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236
AA Change: V163E

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193225
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189039
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Meta Mutation Damage Score 0.9605 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,267 (GRCm39) S466P possibly damaging Het
Ablim1 T C 19: 57,068,298 (GRCm39) T267A probably damaging Het
Acap2 A T 16: 30,922,317 (GRCm39) L724Q possibly damaging Het
Acsbg3 A G 17: 57,195,655 (GRCm39) N684S probably benign Het
Adcy4 T C 14: 56,019,384 (GRCm39) T89A possibly damaging Het
Agrp T C 8: 106,294,000 (GRCm39) E41G probably benign Het
Ajm1 T C 2: 25,468,765 (GRCm39) Y382C probably damaging Het
Akr1d1 G A 6: 37,541,426 (GRCm39) V308M probably damaging Het
Ap1m2 C T 9: 21,220,970 (GRCm39) R54Q probably benign Het
Arhgap45 T A 10: 79,862,900 (GRCm39) V692E probably damaging Het
Arid5b G T 10: 68,078,925 (GRCm39) N137K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
BC048679 T C 7: 81,145,468 (GRCm39) N27D probably benign Het
Ccdc78 A G 17: 26,007,674 (GRCm39) N237S probably benign Het
Cd46 G A 1: 194,744,704 (GRCm39) L345F possibly damaging Het
Cngb3 A T 4: 19,425,569 (GRCm39) N459I possibly damaging Het
Ctnnd2 A G 15: 30,881,313 (GRCm39) E731G probably damaging Het
Ctsh A G 9: 89,936,601 (GRCm39) E26G probably benign Het
Cul1 G T 6: 47,494,080 (GRCm39) K464N probably benign Het
Cul1 T A 6: 47,494,125 (GRCm39) S479R probably damaging Het
Dcaf5 A T 12: 80,387,006 (GRCm39) D373E probably benign Het
Dhcr7 A G 7: 143,394,237 (GRCm39) Q126R probably benign Het
Dok2 T C 14: 71,014,956 (GRCm39) F228L probably damaging Het
Dpep3 T G 8: 106,702,821 (GRCm39) I314L probably benign Het
Eps8 A G 6: 137,491,293 (GRCm39) F362L probably damaging Het
Espn G T 4: 152,223,303 (GRCm39) R250S probably damaging Het
Faf1 A C 4: 109,600,093 (GRCm39) N163H probably damaging Het
Fcho1 C T 8: 72,163,125 (GRCm39) V635I probably benign Het
Garin5b C T 7: 4,760,468 (GRCm39) probably null Het
Gask1b C A 3: 79,843,981 (GRCm39) S36* probably null Het
Gm7579 G A 7: 141,765,645 (GRCm39) C17Y unknown Het
Gpx8 G T 13: 113,182,042 (GRCm39) Y130* probably null Het
Gvin1 A T 7: 105,762,643 (GRCm39) Y609N possibly damaging Het
Hectd4 T A 5: 121,443,881 (GRCm39) M30K probably benign Het
Iqub T C 6: 24,450,841 (GRCm39) D586G probably damaging Het
Klhl25 T C 7: 75,516,798 (GRCm39) I568T probably benign Het
Larp6 A G 9: 60,645,093 (GRCm39) E411G probably damaging Het
Lepr A C 4: 101,646,534 (GRCm39) I822L probably benign Het
Lrig3 C A 10: 125,846,921 (GRCm39) D896E probably benign Het
Lrp1 C T 10: 127,389,693 (GRCm39) G3114D probably damaging Het
Lyset A T 12: 102,710,314 (GRCm39) probably benign Het
Macf1 A T 4: 123,380,543 (GRCm39) Y1263N probably damaging Het
Mapk10 T C 5: 103,138,485 (GRCm39) D180G probably damaging Het
Mbd4 A T 6: 115,825,887 (GRCm39) F368Y possibly damaging Het
Mcpt8 G A 14: 56,319,737 (GRCm39) R238W probably benign Het
Mcrip2 G T 17: 26,083,621 (GRCm39) T86N possibly damaging Het
Mink1 A G 11: 70,502,418 (GRCm39) N1043S probably damaging Het
Muc4 G A 16: 32,754,616 (GRCm38) G1497R probably benign Het
Muc4 T A 16: 32,754,625 (GRCm38) S1500T probably benign Het
Nbeal2 G A 9: 110,464,262 (GRCm39) T1128I probably benign Het
Nrg2 T A 18: 36,329,600 (GRCm39) Y205F probably damaging Het
Nubp2 A G 17: 25,103,430 (GRCm39) M149T probably benign Het
Or4d2b T A 11: 87,780,051 (GRCm39) M224L probably damaging Het
Or8d6 G T 9: 39,853,800 (GRCm39) M81I probably benign Het
Or8j3c T C 2: 86,253,301 (GRCm39) T240A probably damaging Het
Pax3 A G 1: 78,169,093 (GRCm39) I191T possibly damaging Het
Pdcd5 T C 7: 35,343,135 (GRCm39) N137D possibly damaging Het
Pik3c2a G A 7: 115,939,391 (GRCm39) A1649V probably damaging Het
Pkhd1l1 T C 15: 44,400,774 (GRCm39) S2183P possibly damaging Het
Plekho1 T A 3: 95,896,305 (GRCm39) Q388L possibly damaging Het
Ppfibp1 A G 6: 146,892,012 (GRCm39) T91A probably benign Het
Ptger4 G T 15: 5,272,087 (GRCm39) N177K probably benign Het
Reln A G 5: 22,106,749 (GRCm39) F3207S probably benign Het
Rigi G T 4: 40,210,000 (GRCm39) S644R probably damaging Het
Ripk4 C T 16: 97,552,736 (GRCm39) R194H probably damaging Het
Rnf112 A T 11: 61,343,570 (GRCm39) C112S possibly damaging Het
Rprd1b T G 2: 157,916,855 (GRCm39) Y278* probably null Het
Sel1l A G 12: 91,798,376 (GRCm39) L140P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc38a3 A G 9: 107,532,263 (GRCm39) V423A probably damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Slmap A T 14: 26,181,364 (GRCm39) V323E probably benign Het
Smim6 T C 11: 115,804,330 (GRCm39) V39A probably benign Het
Sorbs1 T C 19: 40,325,449 (GRCm39) T382A probably benign Het
Sparc G A 11: 55,290,037 (GRCm39) T218I possibly damaging Het
Steap1 A T 5: 5,786,589 (GRCm39) F283I probably damaging Het
Stil A G 4: 114,895,671 (GRCm39) T586A probably benign Het
Tbce T A 13: 14,194,380 (GRCm39) D93V probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Tex55 A G 16: 38,648,507 (GRCm39) S201P probably damaging Het
Tle4 A T 19: 14,441,709 (GRCm39) I435K probably benign Het
Tmem245 A G 4: 56,899,164 (GRCm39) F254S probably damaging Het
Tubgcp3 T C 8: 12,699,722 (GRCm39) K377R probably benign Het
Ush2a A T 1: 188,285,472 (GRCm39) T2003S probably benign Het
Usp53 A G 3: 122,755,012 (GRCm39) S32P possibly damaging Het
Vmn1r78 T A 7: 11,886,683 (GRCm39) L98Q probably damaging Het
Vmn2r116 A C 17: 23,620,777 (GRCm39) Q837P probably benign Het
Vmn2r3 T C 3: 64,183,022 (GRCm39) I226V probably benign Het
Vmn2r84 T A 10: 130,221,712 (GRCm39) D836V probably damaging Het
Vps13d A G 4: 144,813,731 (GRCm39) F165L probably benign Het
Vstm4 A G 14: 32,585,742 (GRCm39) E103G possibly damaging Het
Zfp870 A T 17: 33,102,314 (GRCm39) C339* probably null Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35,721,442 (GRCm39) missense probably damaging 1.00
IGL03083:Matr3 APN 18 35,705,471 (GRCm39) missense probably damaging 0.96
IGL03117:Matr3 APN 18 35,705,710 (GRCm39) missense probably damaging 1.00
IGL03163:Matr3 APN 18 35,705,644 (GRCm39) missense probably damaging 0.99
IGL03381:Matr3 APN 18 35,712,078 (GRCm39) splice site probably benign
R0456:Matr3 UTSW 18 35,705,917 (GRCm39) missense probably damaging 1.00
R1136:Matr3 UTSW 18 35,705,948 (GRCm39) missense probably damaging 1.00
R1459:Matr3 UTSW 18 35,717,709 (GRCm39) missense probably benign 0.28
R1850:Matr3 UTSW 18 35,715,110 (GRCm39) missense probably damaging 1.00
R1929:Matr3 UTSW 18 35,721,378 (GRCm39) splice site probably benign
R2185:Matr3 UTSW 18 35,714,278 (GRCm39) missense probably damaging 1.00
R2366:Matr3 UTSW 18 35,721,448 (GRCm39) missense probably damaging 1.00
R2870:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2870:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2871:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2871:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2872:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2872:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R2873:Matr3 UTSW 18 35,705,349 (GRCm39) missense probably benign 0.25
R3908:Matr3 UTSW 18 35,705,894 (GRCm39) missense probably damaging 1.00
R4400:Matr3 UTSW 18 35,716,969 (GRCm39) missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35,705,171 (GRCm39) missense probably damaging 1.00
R4860:Matr3 UTSW 18 35,714,693 (GRCm39) missense probably damaging 1.00
R4881:Matr3 UTSW 18 35,705,428 (GRCm39) missense probably damaging 1.00
R4908:Matr3 UTSW 18 35,705,754 (GRCm39) missense probably damaging 0.96
R5084:Matr3 UTSW 18 35,715,135 (GRCm39) missense probably damaging 0.99
R5660:Matr3 UTSW 18 35,705,147 (GRCm39) missense probably damaging 0.99
R5709:Matr3 UTSW 18 35,715,015 (GRCm39) missense probably damaging 1.00
R5779:Matr3 UTSW 18 35,717,575 (GRCm39) missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35,720,791 (GRCm39) missense probably benign
R6392:Matr3 UTSW 18 35,717,894 (GRCm39) missense probably benign 0.07
R7062:Matr3 UTSW 18 35,712,072 (GRCm39) critical splice donor site probably null
R7156:Matr3 UTSW 18 35,705,974 (GRCm39) missense probably damaging 0.98
R7228:Matr3 UTSW 18 35,695,537 (GRCm39) missense unknown
R7389:Matr3 UTSW 18 35,717,638 (GRCm39) missense probably benign
R8940:Matr3 UTSW 18 35,705,640 (GRCm39) missense probably damaging 0.98
R9071:Matr3 UTSW 18 35,705,803 (GRCm39) missense possibly damaging 0.94
R9159:Matr3 UTSW 18 35,712,355 (GRCm39) missense possibly damaging 0.71
R9205:Matr3 UTSW 18 35,720,774 (GRCm39) missense probably benign 0.08
R9587:Matr3 UTSW 18 35,717,876 (GRCm39) missense probably null 0.13
Predicted Primers PCR Primer
(F):5'- TTTCAGCTTGAACACTGTGGTC -3'
(R):5'- ACGACCAAGTTCTTGCTTTTG -3'

Sequencing Primer
(F):5'- CAGCTTGAACACTGTGGTCTTTTG -3'
(R):5'- GACCAAGTTCTTGCTTTTGATCAAAC -3'
Posted On 2016-03-01