Mutagenetix > Incidental Mutation

Incidental Mutation 'R4860:Sorbs1'

372471

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

042471-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.705) question?

Stock #

R4860 (G1)

Quality Score

149

Status

Not validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40337005 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 382 (T382A)

Ref Sequence

ENSEMBL: ENSMUSP00000153336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099466
AA Change: T352A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: T352A

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099467
AA Change: T606A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: T606A

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165212
AA Change: T392A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: T392A

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165469
AA Change: T382A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: T382A

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224227

Predicted Effect

probably benign
Transcript: ENSMUST00000224247
AA Change: T352A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000224667
AA Change: T413A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000225148
AA Change: T352A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000225153
AA Change: T606A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000225786
AA Change: T382A

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226028

Predicted Effect

probably benign
Transcript: ENSMUST00000226047
AA Change: T363A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,423	S466P	possibly damaging	Het
1700061G19Rik	A	G	17: 56,888,655	N684S	probably benign	Het
4930435E12Rik	A	G	16: 38,828,145	S201P	probably damaging	Het
Ablim1	T	C	19: 57,079,866	T267A	probably damaging	Het
Acap2	A	T	16: 31,103,499	L724Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,927	T89A	possibly damaging	Het
Agrp	T	C	8: 105,567,368	E41G	probably benign	Het
Akr1d1	G	A	6: 37,564,491	V308M	probably damaging	Het
Ap1m2	C	T	9: 21,309,674	R54Q	probably benign	Het
Arhgap45	T	A	10: 80,027,066	V692E	probably damaging	Het
Arid5b	G	T	10: 68,243,095	N137K	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
BC048679	T	C	7: 81,495,720	N27D	probably benign	Het
Ccdc78	A	G	17: 25,788,700	N237S	probably benign	Het
Cd46	G	A	1: 195,062,396	L345F	possibly damaging	Het
Cngb3	A	T	4: 19,425,569	N459I	possibly damaging	Het
Ctnnd2	A	G	15: 30,881,167	E731G	probably damaging	Het
Ctsh	A	G	9: 90,054,548	E26G	probably benign	Het
Cul1	G	T	6: 47,517,146	K464N	probably benign	Het
Cul1	T	A	6: 47,517,191	S479R	probably damaging	Het
Dcaf5	A	T	12: 80,340,232	D373E	probably benign	Het
Ddx58	G	T	4: 40,210,000	S644R	probably damaging	Het
Dhcr7	A	G	7: 143,840,500	Q126R	probably benign	Het
Dok2	T	C	14: 70,777,516	F228L	probably damaging	Het
Dpep3	T	G	8: 105,976,189	I314L	probably benign	Het
Eps8	A	G	6: 137,514,295	F362L	probably damaging	Het
Espn	G	T	4: 152,138,846	R250S	probably damaging	Het
Faf1	A	C	4: 109,742,896	N163H	probably damaging	Het
Fam198b	C	A	3: 79,936,674	S36*	probably null	Het
Fam71e2	C	T	7: 4,757,469		probably null	Het
Fcho1	C	T	8: 71,710,481	V635I	probably benign	Het
Gm7579	G	A	7: 142,211,908	C17Y	unknown	Het
Gm996	T	C	2: 25,578,753	Y382C	probably damaging	Het
Gpx8	G	T	13: 113,045,508	Y130*	probably null	Het
Gvin1	A	T	7: 106,163,436	Y609N	possibly damaging	Het
Hectd4	T	A	5: 121,305,818	M30K	probably benign	Het
Iqub	T	C	6: 24,450,842	D586G	probably damaging	Het
Klhl25	T	C	7: 75,867,050	I568T	probably benign	Het
Larp6	A	G	9: 60,737,810	E411G	probably damaging	Het
Lepr	A	C	4: 101,789,337	I822L	probably benign	Het
Lrig3	C	A	10: 126,011,052	D896E	probably benign	Het
Lrp1	C	T	10: 127,553,824	G3114D	probably damaging	Het
Macf1	A	T	4: 123,486,750	Y1263N	probably damaging	Het
Mapk10	T	C	5: 102,990,619	D180G	probably damaging	Het
Matr3	T	A	18: 35,581,640	V113E	probably damaging	Het
Mbd4	A	T	6: 115,848,926	F368Y	possibly damaging	Het
Mcpt8	G	A	14: 56,082,280	R238W	probably benign	Het
Mcrip2	G	T	17: 25,864,647	T86N	possibly damaging	Het
Mink1	A	G	11: 70,611,592	N1043S	probably damaging	Het
Muc4	G	A	16: 32,754,616	G1497R	probably benign	Het
Muc4	T	A	16: 32,754,625	S1500T	probably benign	Het
Nbeal2	G	A	9: 110,635,194	T1128I	probably benign	Het
Nrg2	T	A	18: 36,196,547	Y205F	probably damaging	Het
Nubp2	A	G	17: 24,884,456	M149T	probably benign	Het
Olfr1062	T	C	2: 86,422,957	T240A	probably damaging	Het
Olfr462	T	A	11: 87,889,225	M224L	probably damaging	Het
Olfr974	G	T	9: 39,942,504	M81I	probably benign	Het
Pax3	A	G	1: 78,192,456	I191T	possibly damaging	Het
Pdcd5	T	C	7: 35,643,710	N137D	possibly damaging	Het
Pik3c2a	G	A	7: 116,340,156	A1649V	probably damaging	Het
Pkhd1l1	T	C	15: 44,537,378	S2183P	possibly damaging	Het
Plekho1	T	A	3: 95,988,993	Q388L	possibly damaging	Het
Ppfibp1	A	G	6: 146,990,514	T91A	probably benign	Het
Ptger4	G	T	15: 5,242,606	N177K	probably benign	Het
Reln	A	G	5: 21,901,751	F3207S	probably benign	Het
Ripk4	C	T	16: 97,751,536	R194H	probably damaging	Het
Rnf112	A	T	11: 61,452,744	C112S	possibly damaging	Het
Rprd1b	T	G	2: 158,074,935	Y278*	probably null	Het
Sel1l	A	G	12: 91,831,602	L140P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc38a3	A	G	9: 107,655,064	V423A	probably damaging	Het
Slitrk6	T	C	14: 110,751,883	T131A	probably damaging	Het
Slmap	A	T	14: 26,460,209	V323E	probably benign	Het
Smim6	T	C	11: 115,913,504	V39A	probably benign	Het
Sparc	G	A	11: 55,399,211	T218I	possibly damaging	Het
Steap1	A	T	5: 5,736,589	F283I	probably damaging	Het
Stil	A	G	4: 115,038,474	T586A	probably benign	Het
Tbce	T	A	13: 14,019,795	D93V	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Tle4	A	T	19: 14,464,345	I435K	probably benign	Het
Tmem245	A	G	4: 56,899,164	F254S	probably damaging	Het
Tmem251	A	T	12: 102,744,055		probably benign	Het
Tubgcp3	T	C	8: 12,649,722	K377R	probably benign	Het
Ush2a	A	T	1: 188,553,275	T2003S	probably benign	Het
Usp53	A	G	3: 122,961,363	S32P	possibly damaging	Het
Vmn1r78	T	A	7: 12,152,756	L98Q	probably damaging	Het
Vmn2r116	A	C	17: 23,401,803	Q837P	probably benign	Het
Vmn2r3	T	C	3: 64,275,601	I226V	probably benign	Het
Vmn2r84	T	A	10: 130,385,843	D836V	probably damaging	Het
Vps13d	A	G	4: 145,087,161	F165L	probably benign	Het
Vstm4	A	G	14: 32,863,785	E103G	possibly damaging	Het
Zfp870	A	T	17: 32,883,340	C339*	probably null	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6908:Sorbs1	UTSW	19	40352332	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7040:Sorbs1	UTSW	19	40376800	missense	probably benign
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7401:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40326489	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8699:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9551:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9552:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9686:Sorbs1	UTSW	19	40393510	missense	probably damaging	1.00
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAAAGCATGTGACAGCCCAG -3'
(R):5'- ACCTAGGAGCCCTAAATCTTTCCTAG -3'

Sequencing Primer
(F):5'- CCAAAGCCTTTACTGCCT -3'
(R):5'- AGCCCAAAGTCCTTGTGC -3'

Posted On

2016-03-01