Mutagenetix > Incidental Mutation

Incidental Mutation 'R4827:Olfr1272'

372477

Institutional Source

Beutler Lab

Gene Symbol

Olfr1272

Ensembl Gene

ENSMUSG00000075061

Gene Name

olfactory receptor 1272

Synonyms

GA_x6K02T2Q125-51636504-51635578, MOR227-3

MMRRC Submission

042443-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R4827 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90280263-90292841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90282203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 124 (I124N)

Ref Sequence

ENSEMBL: ENSMUSP00000150745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]

AlphaFold

Q8VGN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000099750
AA Change: I124N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: I124N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	7.5e-52	PFAM
Pfam:7TM_GPCR_Srsx	33	300	1.5e-5	PFAM
Pfam:7tm_1	39	285	1.8e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117141
AA Change: I124N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921507P07Rik	A	C	6: 50,595,856	S26A	possibly damaging	Het
4931408C20Rik	T	C	1: 26,685,842	K86E	possibly damaging	Het
Adck1	A	G	12: 88,446,719	R274G	probably benign	Het
Agbl5	T	G	5: 30,895,814	S83R	probably damaging	Het
Ankib1	A	G	5: 3,701,907	I711T	probably damaging	Het
Arnt	T	A	3: 95,489,913		probably null	Het
Atad2	C	G	15: 58,108,348	V702L	probably benign	Het
B4galnt4	A	G	7: 141,068,479	E636G	probably benign	Het
Btbd2	A	G	10: 80,646,389	I244T	probably damaging	Het
Cenpc1	A	T	5: 86,034,431	N531K	possibly damaging	Het
Ces3b	T	A	8: 105,086,895	M266K	probably benign	Het
Cfap54	A	T	10: 92,902,075		probably benign	Het
Coq8a	A	G	1: 180,167,338	V590A	possibly damaging	Het
Drc7	A	G	8: 95,071,639	Y504C	probably damaging	Het
Elovl4	T	C	9: 83,806,038	M1V	probably null	Het
Exd1	C	T	2: 119,520,326	A485T	probably benign	Het
Fads2	A	G	19: 10,082,594	F239L	probably benign	Het
Gcc2	A	T	10: 58,286,131		probably null	Het
Ggact	C	T	14: 122,891,575	R76H	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3739	A	T	14: 7,300,349	F13I	probably damaging	Het
Gm6768	C	T	12: 119,261,794		noncoding transcript	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gng2	T	C	14: 19,875,830	K65E	possibly damaging	Het
Gnmt	A	G	17: 46,727,319	Y94H	possibly damaging	Het
Gzme	C	A	14: 56,119,298	R69M	probably null	Het
Hdc	G	A	2: 126,594,313	P546L	probably benign	Het
Ibtk	C	A	9: 85,728,554	V326F	probably benign	Het
Inpp5b	G	T	4: 124,743,850		probably benign	Het
Kcnh7	A	T	2: 62,716,220	C1006S	probably benign	Het
Kcnk18	A	T	19: 59,219,930	N66I	probably damaging	Het
Lpar6	T	A	14: 73,238,750	N50K	probably damaging	Het
Lrba	G	T	3: 86,360,150	D1716Y	possibly damaging	Het
Ltf	T	A	9: 111,027,377		probably benign	Het
Map3k6	A	G	4: 133,248,849	T794A	possibly damaging	Het
Mcm8	A	G	2: 132,823,254	T217A	probably damaging	Het
Meaf6	A	G	4: 125,102,920	E141G	probably damaging	Het
Mmp13	A	G	9: 7,278,880	T324A	possibly damaging	Het
Msl2	T	G	9: 101,102,151	F575V	probably benign	Het
Nlrp2	A	T	7: 5,328,951	W149R	possibly damaging	Het
Ntng1	C	A	3: 110,135,411	C33F	probably damaging	Het
Nxn	A	G	11: 76,261,592	Y359H	probably benign	Het
Olfml2a	A	C	2: 38,960,021	D583A	probably damaging	Het
Olfr330	A	G	11: 58,529,596	I130T	probably damaging	Het
Olfr392	A	T	11: 73,814,721	Y120*	probably null	Het
Olfr536	A	C	7: 140,503,670	L263R	probably damaging	Het
Olfr616	A	T	7: 103,564,545	S245T	probably damaging	Het
Pcdha4	T	C	18: 36,953,198	S145P	probably damaging	Het
Pcsk2	A	T	2: 143,801,179	K459*	probably null	Het
Pirb	C	T	7: 3,717,603	G299S	probably benign	Het
Plch2	A	G	4: 154,991,113	F653S	probably damaging	Het
Plpp3	T	C	4: 105,230,970	I296T	probably benign	Het
Polr2b	A	G	5: 77,342,551	E846G	probably benign	Het
Ptpro	A	T	6: 137,442,710	N157Y	probably damaging	Het
Ralgapa1	A	G	12: 55,676,437	L1815P	probably damaging	Het
Sap18	A	G	14: 57,798,563	N69D	probably damaging	Het
Sncg	C	A	14: 34,373,327	V74F	probably damaging	Het
Tmem186	A	T	16: 8,635,817	Y193*	probably null	Het
Trrap	A	G	5: 144,800,948	S1045G	probably benign	Het
Tti2	T	G	8: 31,150,970	S41A	probably benign	Het
Unc13c	T	C	9: 73,931,286	E761G	probably damaging	Het
Vamp2	T	A	11: 69,089,811	D68E	probably benign	Het
Vmn1r200	A	T	13: 22,395,095	M14L	probably benign	Het
Vps35	T	A	8: 85,273,557	D480V	possibly damaging	Het
Zfp462	T	C	4: 55,012,213	L1393P	probably damaging	Het
Zfp512	G	A	5: 31,472,814	M274I	probably benign	Het
Znfx1	C	G	2: 167,044,231	G803A	possibly damaging	Het

Other mutations in Olfr1272

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Olfr1272	APN	2	90282081	missense	possibly damaging	0.55
IGL01824:Olfr1272	APN	2	90281919	missense	probably damaging	1.00
IGL01951:Olfr1272	APN	2	90282007	missense	probably damaging	1.00
IGL02473:Olfr1272	APN	2	90281696	missense	probably null	1.00
IGL02494:Olfr1272	APN	2	90281951	missense	probably benign	0.35
IGL03410:Olfr1272	APN	2	90282213	missense	probably damaging	1.00
R0350:Olfr1272	UTSW	2	90282582	splice site	probably null
R0363:Olfr1272	UTSW	2	90281856	missense	probably damaging	1.00
R0401:Olfr1272	UTSW	2	90282404	missense	probably damaging	1.00
R0666:Olfr1272	UTSW	2	90281868	missense	probably damaging	0.96
R1860:Olfr1272	UTSW	2	90282158	missense	probably damaging	1.00
R1861:Olfr1272	UTSW	2	90282158	missense	probably damaging	1.00
R2374:Olfr1272	UTSW	2	90282451	missense	possibly damaging	0.76
R4256:Olfr1272	UTSW	2	90282062	missense	probably damaging	1.00
R4737:Olfr1272	UTSW	2	90282381	missense	probably damaging	1.00
R5198:Olfr1272	UTSW	2	90296393	missense	probably damaging	1.00
R5589:Olfr1272	UTSW	2	90281969	missense	probably damaging	1.00
R6412:Olfr1272	UTSW	2	90281858	missense	probably damaging	1.00
R7130:Olfr1272	UTSW	2	90281922	missense	probably benign
R7317:Olfr1272	UTSW	2	90282404	missense	probably damaging	1.00
R7497:Olfr1272	UTSW	2	90281754	missense	possibly damaging	0.74
R7762:Olfr1272	UTSW	2	90296631	nonsense	probably null
R8271:Olfr1272	UTSW	2	90282272	missense	possibly damaging	0.74
R8347:Olfr1272	UTSW	2	90281676	missense	probably benign	0.22
R8703:Olfr1272	UTSW	2	90296493	missense	probably damaging	1.00
R8794:Olfr1272	UTSW	2	90281806	nonsense	probably null
R8824:Olfr1272	UTSW	2	90296012	missense	probably damaging	0.98
R8910:Olfr1272	UTSW	2	90296504	missense	possibly damaging	0.80
R8934:Olfr1272	UTSW	2	90282012	missense	probably benign	0.07
R9548:Olfr1272	UTSW	2	90281647	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTTGGCCATCACAACAAC -3'
(R):5'- TCCCTGGTGGAGATCTGTTACTC -3'

Sequencing Primer
(F):5'- CTTCCATAAAGGTGTCAGTGCAG -3'
(R):5'- GGAGATCTGTTACTCCTCTACAATTG -3'

Posted On

2016-03-01