Incidental Mutation 'R4827:Or4b1b'
ID 372477
Institutional Source Beutler Lab
Gene Symbol Or4b1b
Ensembl Gene ENSMUSG00000075061
Gene Name olfactory receptor family 4 subfamily B member 1B
Synonyms Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 042443-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4827 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90111991-90112917 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90112547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 124 (I124N)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
AlphaFold Q8VGN8
Predicted Effect probably damaging
Transcript: ENSMUST00000099750
AA Change: I124N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: I124N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117141
AA Change: I124N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,413,489 (GRCm39) R274G probably benign Het
Agbl5 T G 5: 31,053,158 (GRCm39) S83R probably damaging Het
Ankib1 A G 5: 3,751,907 (GRCm39) I711T probably damaging Het
Arnt T A 3: 95,397,224 (GRCm39) probably null Het
Atad2 C G 15: 57,971,744 (GRCm39) V702L probably benign Het
B4galnt4 A G 7: 140,648,392 (GRCm39) E636G probably benign Het
Btbd2 A G 10: 80,482,223 (GRCm39) I244T probably damaging Het
Cenpc1 A T 5: 86,182,290 (GRCm39) N531K possibly damaging Het
Ces3b T A 8: 105,813,527 (GRCm39) M266K probably benign Het
Cfap54 A T 10: 92,737,937 (GRCm39) probably benign Het
Coq8a A G 1: 179,994,903 (GRCm39) V590A possibly damaging Het
Drc7 A G 8: 95,798,267 (GRCm39) Y504C probably damaging Het
Elovl4 T C 9: 83,688,091 (GRCm39) M1V probably null Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Fads2 A G 19: 10,059,958 (GRCm39) F239L probably benign Het
Gcc2 A T 10: 58,121,953 (GRCm39) probably null Het
Ggact C T 14: 123,128,987 (GRCm39) R76H probably benign Het
Gm17535 T A 9: 3,035,786 (GRCm39) L218H probably benign Het
Gm3739 A T 14: 18,506,218 (GRCm39) F13I probably damaging Het
Gng2 T C 14: 19,925,898 (GRCm39) K65E possibly damaging Het
Gnmt A G 17: 47,038,245 (GRCm39) Y94H possibly damaging Het
Gzme C A 14: 56,356,755 (GRCm39) R69M probably null Het
Hdc G A 2: 126,436,233 (GRCm39) P546L probably benign Het
Ibtk C A 9: 85,610,607 (GRCm39) V326F probably benign Het
Inpp5b G T 4: 124,637,643 (GRCm39) probably benign Het
Kcnh7 A T 2: 62,546,564 (GRCm39) C1006S probably benign Het
Kcnk18 A T 19: 59,208,362 (GRCm39) N66I probably damaging Het
Lpar6 T A 14: 73,476,190 (GRCm39) N50K probably damaging Het
Lrba G T 3: 86,267,457 (GRCm39) D1716Y possibly damaging Het
Ltf T A 9: 110,856,445 (GRCm39) probably benign Het
Map3k6 A G 4: 132,976,160 (GRCm39) T794A possibly damaging Het
Mcm8 A G 2: 132,665,174 (GRCm39) T217A probably damaging Het
Meaf6 A G 4: 124,996,713 (GRCm39) E141G probably damaging Het
Mmp13 A G 9: 7,278,880 (GRCm39) T324A possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msl2 T G 9: 100,979,350 (GRCm39) F575V probably benign Het
Ncoa4-ps C T 12: 119,225,529 (GRCm39) noncoding transcript Het
Nlrp2 A T 7: 5,331,950 (GRCm39) W149R possibly damaging Het
Ntng1 C A 3: 110,042,727 (GRCm39) C33F probably damaging Het
Nxn A G 11: 76,152,418 (GRCm39) Y359H probably benign Het
Olfml2a A C 2: 38,850,033 (GRCm39) D583A probably damaging Het
Or12j5 A C 7: 140,083,583 (GRCm39) L263R probably damaging Het
Or1e32 A T 11: 73,705,547 (GRCm39) Y120* probably null Het
Or2t48 A G 11: 58,420,422 (GRCm39) I130T probably damaging Het
Or51ac3 A T 7: 103,213,752 (GRCm39) S245T probably damaging Het
Pcdha4 T C 18: 37,086,251 (GRCm39) S145P probably damaging Het
Pcsk2 A T 2: 143,643,099 (GRCm39) K459* probably null Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Plch2 A G 4: 155,075,570 (GRCm39) F653S probably damaging Het
Plpp3 T C 4: 105,088,167 (GRCm39) I296T probably benign Het
Polr2b A G 5: 77,490,398 (GRCm39) E846G probably benign Het
Ptpro A T 6: 137,419,708 (GRCm39) N157Y probably damaging Het
Ralgapa1 A G 12: 55,723,222 (GRCm39) L1815P probably damaging Het
Sap18 A G 14: 58,036,020 (GRCm39) N69D probably damaging Het
Sncg C A 14: 34,095,284 (GRCm39) V74F probably damaging Het
Spata31e2 T C 1: 26,724,923 (GRCm39) K86E possibly damaging Het
Spmip4 A C 6: 50,572,836 (GRCm39) S26A possibly damaging Het
Tmem186 A T 16: 8,453,681 (GRCm39) Y193* probably null Het
Trrap A G 5: 144,737,758 (GRCm39) S1045G probably benign Het
Tti2 T G 8: 31,640,998 (GRCm39) S41A probably benign Het
Unc13c T C 9: 73,838,568 (GRCm39) E761G probably damaging Het
Vamp2 T A 11: 68,980,637 (GRCm39) D68E probably benign Het
Vmn1r200 A T 13: 22,579,265 (GRCm39) M14L probably benign Het
Vps35 T A 8: 86,000,186 (GRCm39) D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 (GRCm39) L1393P probably damaging Het
Zfp512 G A 5: 31,630,158 (GRCm39) M274I probably benign Het
Znfx1 C G 2: 166,886,151 (GRCm39) G803A possibly damaging Het
Other mutations in Or4b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Or4b1b APN 2 90,112,425 (GRCm39) missense possibly damaging 0.55
IGL01824:Or4b1b APN 2 90,112,263 (GRCm39) missense probably damaging 1.00
IGL01951:Or4b1b APN 2 90,112,351 (GRCm39) missense probably damaging 1.00
IGL02473:Or4b1b APN 2 90,112,040 (GRCm39) missense probably null 1.00
IGL02494:Or4b1b APN 2 90,112,295 (GRCm39) missense probably benign 0.35
IGL03410:Or4b1b APN 2 90,112,557 (GRCm39) missense probably damaging 1.00
R0350:Or4b1b UTSW 2 90,112,926 (GRCm39) splice site probably null
R0363:Or4b1b UTSW 2 90,112,200 (GRCm39) missense probably damaging 1.00
R0401:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R0666:Or4b1b UTSW 2 90,112,212 (GRCm39) missense probably damaging 0.96
R1860:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R1861:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R2374:Or4b1b UTSW 2 90,112,795 (GRCm39) missense possibly damaging 0.76
R4256:Or4b1b UTSW 2 90,112,406 (GRCm39) missense probably damaging 1.00
R4737:Or4b1b UTSW 2 90,112,725 (GRCm39) missense probably damaging 1.00
R5198:Or4b1b UTSW 2 90,126,737 (GRCm39) missense probably damaging 1.00
R5589:Or4b1b UTSW 2 90,112,313 (GRCm39) missense probably damaging 1.00
R6412:Or4b1b UTSW 2 90,112,202 (GRCm39) missense probably damaging 1.00
R7130:Or4b1b UTSW 2 90,112,266 (GRCm39) missense probably benign
R7317:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R7497:Or4b1b UTSW 2 90,112,098 (GRCm39) missense possibly damaging 0.74
R7762:Or4b1b UTSW 2 90,126,975 (GRCm39) nonsense probably null
R8271:Or4b1b UTSW 2 90,112,616 (GRCm39) missense possibly damaging 0.74
R8347:Or4b1b UTSW 2 90,112,020 (GRCm39) missense probably benign 0.22
R8703:Or4b1b UTSW 2 90,126,837 (GRCm39) missense probably damaging 1.00
R8794:Or4b1b UTSW 2 90,112,150 (GRCm39) nonsense probably null
R8824:Or4b1b UTSW 2 90,126,356 (GRCm39) missense probably damaging 0.98
R8910:Or4b1b UTSW 2 90,126,848 (GRCm39) missense possibly damaging 0.80
R8934:Or4b1b UTSW 2 90,112,356 (GRCm39) missense probably benign 0.07
R9548:Or4b1b UTSW 2 90,111,991 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGGCCATCACAACAAC -3'
(R):5'- TCCCTGGTGGAGATCTGTTACTC -3'

Sequencing Primer
(F):5'- CTTCCATAAAGGTGTCAGTGCAG -3'
(R):5'- GGAGATCTGTTACTCCTCTACAATTG -3'
Posted On 2016-03-01