Incidental Mutation 'R4827:Ankib1'
ID 372492
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Name ankyrin repeat and IBR domain containing 1
Synonyms 2310061P20Rik, 4631416I11Rik
MMRRC Submission 042443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4827 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 3690000-3802925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3701907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 711 (I711T)
Ref Sequence ENSEMBL: ENSMUSP00000142687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
AlphaFold Q6ZPS6
Predicted Effect probably damaging
Transcript: ENSMUST00000043551
AA Change: I711T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: I711T

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200052
Predicted Effect probably damaging
Transcript: ENSMUST00000200335
AA Change: I711T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: I711T

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Meta Mutation Damage Score 0.7342 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A C 6: 50,595,856 S26A possibly damaging Het
4931408C20Rik T C 1: 26,685,842 K86E possibly damaging Het
Adck1 A G 12: 88,446,719 R274G probably benign Het
Agbl5 T G 5: 30,895,814 S83R probably damaging Het
Arnt T A 3: 95,489,913 probably null Het
Atad2 C G 15: 58,108,348 V702L probably benign Het
B4galnt4 A G 7: 141,068,479 E636G probably benign Het
Btbd2 A G 10: 80,646,389 I244T probably damaging Het
Cenpc1 A T 5: 86,034,431 N531K possibly damaging Het
Ces3b T A 8: 105,086,895 M266K probably benign Het
Cfap54 A T 10: 92,902,075 probably benign Het
Coq8a A G 1: 180,167,338 V590A possibly damaging Het
Drc7 A G 8: 95,071,639 Y504C probably damaging Het
Elovl4 T C 9: 83,806,038 M1V probably null Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fads2 A G 19: 10,082,594 F239L probably benign Het
Gcc2 A T 10: 58,286,131 probably null Het
Ggact C T 14: 122,891,575 R76H probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3739 A T 14: 7,300,349 F13I probably damaging Het
Gm6768 C T 12: 119,261,794 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 T C 14: 19,875,830 K65E possibly damaging Het
Gnmt A G 17: 46,727,319 Y94H possibly damaging Het
Gzme C A 14: 56,119,298 R69M probably null Het
Hdc G A 2: 126,594,313 P546L probably benign Het
Ibtk C A 9: 85,728,554 V326F probably benign Het
Inpp5b G T 4: 124,743,850 probably benign Het
Kcnh7 A T 2: 62,716,220 C1006S probably benign Het
Kcnk18 A T 19: 59,219,930 N66I probably damaging Het
Lpar6 T A 14: 73,238,750 N50K probably damaging Het
Lrba G T 3: 86,360,150 D1716Y possibly damaging Het
Ltf T A 9: 111,027,377 probably benign Het
Map3k6 A G 4: 133,248,849 T794A possibly damaging Het
Mcm8 A G 2: 132,823,254 T217A probably damaging Het
Meaf6 A G 4: 125,102,920 E141G probably damaging Het
Mmp13 A G 9: 7,278,880 T324A possibly damaging Het
Msl2 T G 9: 101,102,151 F575V probably benign Het
Nlrp2 A T 7: 5,328,951 W149R possibly damaging Het
Ntng1 C A 3: 110,135,411 C33F probably damaging Het
Nxn A G 11: 76,261,592 Y359H probably benign Het
Olfml2a A C 2: 38,960,021 D583A probably damaging Het
Olfr1272 A T 2: 90,282,203 I124N probably damaging Het
Olfr330 A G 11: 58,529,596 I130T probably damaging Het
Olfr392 A T 11: 73,814,721 Y120* probably null Het
Olfr536 A C 7: 140,503,670 L263R probably damaging Het
Olfr616 A T 7: 103,564,545 S245T probably damaging Het
Pcdha4 T C 18: 36,953,198 S145P probably damaging Het
Pcsk2 A T 2: 143,801,179 K459* probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Plch2 A G 4: 154,991,113 F653S probably damaging Het
Plpp3 T C 4: 105,230,970 I296T probably benign Het
Polr2b A G 5: 77,342,551 E846G probably benign Het
Ptpro A T 6: 137,442,710 N157Y probably damaging Het
Ralgapa1 A G 12: 55,676,437 L1815P probably damaging Het
Sap18 A G 14: 57,798,563 N69D probably damaging Het
Sncg C A 14: 34,373,327 V74F probably damaging Het
Tmem186 A T 16: 8,635,817 Y193* probably null Het
Trrap A G 5: 144,800,948 S1045G probably benign Het
Tti2 T G 8: 31,150,970 S41A probably benign Het
Unc13c T C 9: 73,931,286 E761G probably damaging Het
Vamp2 T A 11: 69,089,811 D68E probably benign Het
Vmn1r200 A T 13: 22,395,095 M14L probably benign Het
Vps35 T A 8: 85,273,557 D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 L1393P probably damaging Het
Zfp512 G A 5: 31,472,814 M274I probably benign Het
Znfx1 C G 2: 167,044,231 G803A possibly damaging Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
R8712:Ankib1 UTSW 5 3772643 missense probably benign 0.03
R8750:Ankib1 UTSW 5 3702890 critical splice donor site probably null
R8854:Ankib1 UTSW 5 3727489 missense probably null 0.97
R9032:Ankib1 UTSW 5 3769641 missense probably benign 0.16
R9180:Ankib1 UTSW 5 3706276 missense probably damaging 1.00
R9325:Ankib1 UTSW 5 3772523 missense possibly damaging 0.81
R9474:Ankib1 UTSW 5 3755617 missense probably damaging 0.98
R9504:Ankib1 UTSW 5 3713235 missense probably benign
R9564:Ankib1 UTSW 5 3755733 missense possibly damaging 0.87
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGAGAGTTACACAGTGACAGAC -3'
(R):5'- CAGAGGAATGTTGTCTTCTTGC -3'

Sequencing Primer
(F):5'- TCAGCTATCCATATTGTAGGTGTAAG -3'
(R):5'- GCATTCATGATGACTTAACCTACC -3'
Posted On 2016-03-01