Incidental Mutation 'R4827:Ptpro'
ID 372499
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission 042443-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4827 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137419708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 157 (N157Y)
Ref Sequence ENSEMBL: ENSMUSP00000144870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
AlphaFold E9Q612
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: N1006Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: N1006Y

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: N185Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: N185Y

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: N978Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: N978Y

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: N157Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: N157Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.9545 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,413,489 (GRCm39) R274G probably benign Het
Agbl5 T G 5: 31,053,158 (GRCm39) S83R probably damaging Het
Ankib1 A G 5: 3,751,907 (GRCm39) I711T probably damaging Het
Arnt T A 3: 95,397,224 (GRCm39) probably null Het
Atad2 C G 15: 57,971,744 (GRCm39) V702L probably benign Het
B4galnt4 A G 7: 140,648,392 (GRCm39) E636G probably benign Het
Btbd2 A G 10: 80,482,223 (GRCm39) I244T probably damaging Het
Cenpc1 A T 5: 86,182,290 (GRCm39) N531K possibly damaging Het
Ces3b T A 8: 105,813,527 (GRCm39) M266K probably benign Het
Cfap54 A T 10: 92,737,937 (GRCm39) probably benign Het
Coq8a A G 1: 179,994,903 (GRCm39) V590A possibly damaging Het
Drc7 A G 8: 95,798,267 (GRCm39) Y504C probably damaging Het
Elovl4 T C 9: 83,688,091 (GRCm39) M1V probably null Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Fads2 A G 19: 10,059,958 (GRCm39) F239L probably benign Het
Gcc2 A T 10: 58,121,953 (GRCm39) probably null Het
Ggact C T 14: 123,128,987 (GRCm39) R76H probably benign Het
Gm17535 T A 9: 3,035,786 (GRCm39) L218H probably benign Het
Gm3739 A T 14: 18,506,218 (GRCm39) F13I probably damaging Het
Gng2 T C 14: 19,925,898 (GRCm39) K65E possibly damaging Het
Gnmt A G 17: 47,038,245 (GRCm39) Y94H possibly damaging Het
Gzme C A 14: 56,356,755 (GRCm39) R69M probably null Het
Hdc G A 2: 126,436,233 (GRCm39) P546L probably benign Het
Ibtk C A 9: 85,610,607 (GRCm39) V326F probably benign Het
Inpp5b G T 4: 124,637,643 (GRCm39) probably benign Het
Kcnh7 A T 2: 62,546,564 (GRCm39) C1006S probably benign Het
Kcnk18 A T 19: 59,208,362 (GRCm39) N66I probably damaging Het
Lpar6 T A 14: 73,476,190 (GRCm39) N50K probably damaging Het
Lrba G T 3: 86,267,457 (GRCm39) D1716Y possibly damaging Het
Ltf T A 9: 110,856,445 (GRCm39) probably benign Het
Map3k6 A G 4: 132,976,160 (GRCm39) T794A possibly damaging Het
Mcm8 A G 2: 132,665,174 (GRCm39) T217A probably damaging Het
Meaf6 A G 4: 124,996,713 (GRCm39) E141G probably damaging Het
Mmp13 A G 9: 7,278,880 (GRCm39) T324A possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Msl2 T G 9: 100,979,350 (GRCm39) F575V probably benign Het
Ncoa4-ps C T 12: 119,225,529 (GRCm39) noncoding transcript Het
Nlrp2 A T 7: 5,331,950 (GRCm39) W149R possibly damaging Het
Ntng1 C A 3: 110,042,727 (GRCm39) C33F probably damaging Het
Nxn A G 11: 76,152,418 (GRCm39) Y359H probably benign Het
Olfml2a A C 2: 38,850,033 (GRCm39) D583A probably damaging Het
Or12j5 A C 7: 140,083,583 (GRCm39) L263R probably damaging Het
Or1e32 A T 11: 73,705,547 (GRCm39) Y120* probably null Het
Or2t48 A G 11: 58,420,422 (GRCm39) I130T probably damaging Het
Or4b1b A T 2: 90,112,547 (GRCm39) I124N probably damaging Het
Or51ac3 A T 7: 103,213,752 (GRCm39) S245T probably damaging Het
Pcdha4 T C 18: 37,086,251 (GRCm39) S145P probably damaging Het
Pcsk2 A T 2: 143,643,099 (GRCm39) K459* probably null Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Plch2 A G 4: 155,075,570 (GRCm39) F653S probably damaging Het
Plpp3 T C 4: 105,088,167 (GRCm39) I296T probably benign Het
Polr2b A G 5: 77,490,398 (GRCm39) E846G probably benign Het
Ralgapa1 A G 12: 55,723,222 (GRCm39) L1815P probably damaging Het
Sap18 A G 14: 58,036,020 (GRCm39) N69D probably damaging Het
Sncg C A 14: 34,095,284 (GRCm39) V74F probably damaging Het
Spata31e2 T C 1: 26,724,923 (GRCm39) K86E possibly damaging Het
Spmip4 A C 6: 50,572,836 (GRCm39) S26A possibly damaging Het
Tmem186 A T 16: 8,453,681 (GRCm39) Y193* probably null Het
Trrap A G 5: 144,737,758 (GRCm39) S1045G probably benign Het
Tti2 T G 8: 31,640,998 (GRCm39) S41A probably benign Het
Unc13c T C 9: 73,838,568 (GRCm39) E761G probably damaging Het
Vamp2 T A 11: 68,980,637 (GRCm39) D68E probably benign Het
Vmn1r200 A T 13: 22,579,265 (GRCm39) M14L probably benign Het
Vps35 T A 8: 86,000,186 (GRCm39) D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 (GRCm39) L1393P probably damaging Het
Zfp512 G A 5: 31,630,158 (GRCm39) M274I probably benign Het
Znfx1 C G 2: 166,886,151 (GRCm39) G803A possibly damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2040:Ptpro UTSW 6 137,363,162 (GRCm39) splice site probably benign
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7236:Ptpro UTSW 6 137,345,335 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R7873:Ptpro UTSW 6 137,407,737 (GRCm39) missense probably benign 0.44
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9309:Ptpro UTSW 6 137,431,656 (GRCm39) missense probably damaging 1.00
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9625:Ptpro UTSW 6 137,371,873 (GRCm39) missense probably damaging 1.00
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTGTTAGAATGAGTTTTCCTTCC -3'
(R):5'- TCCTGGACTCTGAACAGGAAC -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACCATGCTGG -3'
(R):5'- ACTCTGAACAGGAACAGCAG -3'
Posted On 2016-03-01