Incidental Mutation 'R4827:Btbd2'
ID372514
Institutional Source Beutler Lab
Gene Symbol Btbd2
Ensembl Gene ENSMUSG00000003344
Gene NameBTB (POZ) domain containing 2
Synonyms
MMRRC Submission 042443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4827 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80642617-80657071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80646389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 244 (I244T)
Ref Sequence ENSEMBL: ENSMUSP00000120751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000126980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003434
AA Change: I259T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344
AA Change: I259T

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126980
AA Change: I244T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344
AA Change: I244T

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131876
AA Change: I128T
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344
AA Change: I128T

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151794
Meta Mutation Damage Score 0.8531 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A C 6: 50,595,856 S26A possibly damaging Het
4931408C20Rik T C 1: 26,685,842 K86E possibly damaging Het
Adck1 A G 12: 88,446,719 R274G probably benign Het
Agbl5 T G 5: 30,895,814 S83R probably damaging Het
Ankib1 A G 5: 3,701,907 I711T probably damaging Het
Arnt T A 3: 95,489,913 probably null Het
Atad2 C G 15: 58,108,348 V702L probably benign Het
B4galnt4 A G 7: 141,068,479 E636G probably benign Het
Cenpc1 A T 5: 86,034,431 N531K possibly damaging Het
Ces3b T A 8: 105,086,895 M266K probably benign Het
Cfap54 A T 10: 92,902,075 probably benign Het
Coq8a A G 1: 180,167,338 V590A possibly damaging Het
Drc7 A G 8: 95,071,639 Y504C probably damaging Het
Elovl4 T C 9: 83,806,038 M1V probably null Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fads2 A G 19: 10,082,594 F239L probably benign Het
Gcc2 A T 10: 58,286,131 probably null Het
Ggact C T 14: 122,891,575 R76H probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3739 A T 14: 7,300,349 F13I probably damaging Het
Gm6768 C T 12: 119,261,794 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 T C 14: 19,875,830 K65E possibly damaging Het
Gnmt A G 17: 46,727,319 Y94H possibly damaging Het
Gzme C A 14: 56,119,298 R69M probably null Het
Hdc G A 2: 126,594,313 P546L probably benign Het
Ibtk C A 9: 85,728,554 V326F probably benign Het
Inpp5b G T 4: 124,743,850 probably benign Het
Kcnh7 A T 2: 62,716,220 C1006S probably benign Het
Kcnk18 A T 19: 59,219,930 N66I probably damaging Het
Lpar6 T A 14: 73,238,750 N50K probably damaging Het
Lrba G T 3: 86,360,150 D1716Y possibly damaging Het
Ltf T A 9: 111,027,377 probably benign Het
Map3k6 A G 4: 133,248,849 T794A possibly damaging Het
Mcm8 A G 2: 132,823,254 T217A probably damaging Het
Meaf6 A G 4: 125,102,920 E141G probably damaging Het
Mmp13 A G 9: 7,278,880 T324A possibly damaging Het
Msl2 T G 9: 101,102,151 F575V probably benign Het
Nlrp2 A T 7: 5,328,951 W149R possibly damaging Het
Ntng1 C A 3: 110,135,411 C33F probably damaging Het
Nxn A G 11: 76,261,592 Y359H probably benign Het
Olfml2a A C 2: 38,960,021 D583A probably damaging Het
Olfr1272 A T 2: 90,282,203 I124N probably damaging Het
Olfr330 A G 11: 58,529,596 I130T probably damaging Het
Olfr392 A T 11: 73,814,721 Y120* probably null Het
Olfr536 A C 7: 140,503,670 L263R probably damaging Het
Olfr616 A T 7: 103,564,545 S245T probably damaging Het
Pcdha4 T C 18: 36,953,198 S145P probably damaging Het
Pcsk2 A T 2: 143,801,179 K459* probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Plch2 A G 4: 154,991,113 F653S probably damaging Het
Plpp3 T C 4: 105,230,970 I296T probably benign Het
Polr2b A G 5: 77,342,551 E846G probably benign Het
Ptpro A T 6: 137,442,710 N157Y probably damaging Het
Ralgapa1 A G 12: 55,676,437 L1815P probably damaging Het
Sap18 A G 14: 57,798,563 N69D probably damaging Het
Sncg C A 14: 34,373,327 V74F probably damaging Het
Tmem186 A T 16: 8,635,817 Y193* probably null Het
Trrap A G 5: 144,800,948 S1045G probably benign Het
Tti2 T G 8: 31,150,970 S41A probably benign Het
Unc13c T C 9: 73,931,286 E761G probably damaging Het
Vamp2 T A 11: 69,089,811 D68E probably benign Het
Vmn1r200 A T 13: 22,395,095 M14L probably benign Het
Vps35 T A 8: 85,273,557 D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 L1393P probably damaging Het
Zfp512 G A 5: 31,472,814 M274I probably benign Het
Znfx1 C G 2: 167,044,231 G803A possibly damaging Het
Other mutations in Btbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
brachio UTSW 10 80645531 missense probably damaging 1.00
R0245:Btbd2 UTSW 10 80647806 missense probably damaging 1.00
R1794:Btbd2 UTSW 10 80643913 missense probably damaging 1.00
R1960:Btbd2 UTSW 10 80644705 missense probably benign 0.06
R5197:Btbd2 UTSW 10 80646419 missense probably damaging 0.98
R5372:Btbd2 UTSW 10 80648641 missense probably damaging 0.99
R6108:Btbd2 UTSW 10 80645531 missense probably damaging 1.00
R6316:Btbd2 UTSW 10 80644778 missense probably damaging 0.98
R6355:Btbd2 UTSW 10 80645349 missense possibly damaging 0.81
R6872:Btbd2 UTSW 10 80644332 missense probably damaging 0.99
R7016:Btbd2 UTSW 10 80648615 missense probably damaging 1.00
R7300:Btbd2 UTSW 10 80644266 missense probably damaging 1.00
R7524:Btbd2 UTSW 10 80646444 missense probably damaging 0.97
R7617:Btbd2 UTSW 10 80646392 missense probably damaging 1.00
R7756:Btbd2 UTSW 10 80648606 missense probably benign 0.05
R7762:Btbd2 UTSW 10 80643556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGGTATCACAGTGATCC -3'
(R):5'- TGTCAGATACCCATGGCTCC -3'

Sequencing Primer
(F):5'- GGTAAGTCCTCAGACACAGGC -3'
(R):5'- CATGCTGGGCAGACTGGTAG -3'
Posted On2016-03-01