Incidental Mutation 'R4828:Ppp1r42'
ID372535
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Nameprotein phosphatase 1, regulatory subunit 42
Synonyms1700011J18Rik, 4930418G15Rik, Lrrc67
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location9968624-10009136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9999411 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 142 (R142H)
Ref Sequence ENSEMBL: ENSMUSP00000115030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
Predicted Effect probably benign
Transcript: ENSMUST00000027049
AA Change: R142H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: R142H

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124874
AA Change: R142H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: R142H

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130102
AA Change: R142H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916
AA Change: R142H

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155163
Predicted Effect probably benign
Transcript: ENSMUST00000176398
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10003233 critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 9968853 missense probably benign 0.34
G1patch:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R0920:Ppp1r42 UTSW 1 9999525 missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10000086 missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10003347 missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10003412 intron probably benign
R4863:Ppp1r42 UTSW 1 10003386 intron probably benign
R5384:Ppp1r42 UTSW 1 9999435 missense probably damaging 1.00
R5394:Ppp1r42 UTSW 1 9999405 missense probably damaging 1.00
R6725:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 9968857 missense probably benign
R7556:Ppp1r42 UTSW 1 9995183 missense probably benign 0.01
R8722:Ppp1r42 UTSW 1 9985669 missense probably benign 0.15
Z1177:Ppp1r42 UTSW 1 9999427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCTAGCCTGAATACTTCC -3'
(R):5'- GCCTCAAAGTCACATCGTTC -3'

Sequencing Primer
(F):5'- CCCTGTTTGAAAACTAACATGGAGG -3'
(R):5'- CGTTCTCAGAAAATCTATTTGAAGCC -3'
Posted On2016-03-01