Incidental Mutation 'R4828:Dnah7b'
ID372537
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46128112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 588 (V588D)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069293
AA Change: V588D

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: V588D

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCAGCCCCACATGTGAATTTG -3'
(R):5'- TTCCATTGCCAAGTGACTCAAAG -3'

Sequencing Primer
(F):5'- ACTCACTATGTAGTCAAGGCTGGC -3'
(R):5'- GTGACTCAAAGACCACTCCTAGAATG -3'
Posted On2016-03-01