Incidental Mutation 'R4828:Selenbp2'
ID372556
Institutional Source Beutler Lab
Gene Symbol Selenbp2
Ensembl Gene ENSMUSG00000068877
Gene Nameselenium binding protein 2
SynonymsAP56, Lpsb2, acetaminophen-binding protein
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94693556-94704413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94704119 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 379 (N379S)
Ref Sequence ENSEMBL: ENSMUSP00000134270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090848] [ENSMUST00000131650] [ENSMUST00000173849]
Predicted Effect probably benign
Transcript: ENSMUST00000090848
AA Change: N441S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088358
Gene: ENSMUSG00000068877
AA Change: N441S

DomainStartEndE-ValueType
Pfam:SBP56 6 472 7.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132162
Predicted Effect probably benign
Transcript: ENSMUST00000173849
AA Change: N379S

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134270
Gene: ENSMUSG00000068877
AA Change: N379S

DomainStartEndE-ValueType
Pfam:SBP56 6 62 4.4e-22 PFAM
Pfam:SBP56 57 410 4.1e-165 PFAM
Pfam:Lactonase 163 296 4.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174377
Meta Mutation Damage Score 0.2859 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Selenbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Selenbp2 APN 3 94698144 missense possibly damaging 0.76
IGL02007:Selenbp2 APN 3 94698154 missense possibly damaging 0.67
IGL02103:Selenbp2 APN 3 94698131 missense probably null
IGL02222:Selenbp2 APN 3 94699962 missense probably damaging 1.00
IGL02441:Selenbp2 APN 3 94704064 missense probably benign 0.02
IGL03086:Selenbp2 APN 3 94699638 missense probably damaging 1.00
R0068:Selenbp2 UTSW 3 94703509 missense probably benign 0.00
R0256:Selenbp2 UTSW 3 94699701 missense probably benign 0.35
R0725:Selenbp2 UTSW 3 94697502 splice site probably benign
R0879:Selenbp2 UTSW 3 94699556 missense possibly damaging 0.76
R1636:Selenbp2 UTSW 3 94696815 missense probably damaging 1.00
R3719:Selenbp2 UTSW 3 94699617 missense probably damaging 1.00
R4962:Selenbp2 UTSW 3 94703549 missense probably damaging 0.99
R6661:Selenbp2 UTSW 3 94702514 missense probably damaging 1.00
R7201:Selenbp2 UTSW 3 94702357 missense probably benign 0.03
R7221:Selenbp2 UTSW 3 94703826 nonsense probably null
R7413:Selenbp2 UTSW 3 94700097 missense probably benign 0.03
X0050:Selenbp2 UTSW 3 94704128 missense probably damaging 0.99
Z1176:Selenbp2 UTSW 3 94698100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCGAAGACTCATCAGG -3'
(R):5'- ATCTCGCTGGTCTCAGAGTG -3'

Sequencing Primer
(F):5'- TTCCGAAGACTCATCAGGAACTC -3'
(R):5'- CTCAGAGTGGCCTTGGAGAG -3'
Posted On2016-03-01