Incidental Mutation 'R4828:Agbl5'
ID372567
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30890715 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 111 (R111H)
Ref Sequence ENSEMBL: ENSMUSP00000144274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124908
AA Change: R111H

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121389
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148394
AA Change: R592H
Predicted Effect probably damaging
Transcript: ENSMUST00000200695
AA Change: R111H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200850
AA Change: R111H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201167
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201523
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201901
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201918
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: R111H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: R111H

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202757
Meta Mutation Damage Score 0.2163 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R7452:Agbl5 UTSW 5 30893391 missense probably damaging 1.00
R8312:Agbl5 UTSW 5 30894506 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGACTTGATTTGATTCAGCTTTCC -3'
(R):5'- CAGCTTCTTCAGGCTTGCTG -3'

Sequencing Primer
(F):5'- GATTTGATTCAGCTTTCCCCACATC -3'
(R):5'- CAGGGGCTCAGCTTGGAC -3'
Posted On2016-03-01