Incidental Mutation 'R4828:Abca14'
ID372585
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene NameATP-binding cassette, sub-family A (ABC1), member 14
Synonyms1700110B15Rik, 4930539G24Rik
MMRRC Submission 042444-MU
Accession Numbers

Genbank: NM_026458; MGI: 2388708

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120203961-120325352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120216247 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 239 (R239S)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
Predicted Effect probably damaging
Transcript: ENSMUST00000084640
AA Change: R239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: R239S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dip2c T A 13: 9,560,679 W356R probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 120246853 missense probably damaging 1.00
IGL00800:Abca14 APN 7 120255390 missense probably benign 0.01
IGL00845:Abca14 APN 7 120223951 splice site probably benign
IGL00897:Abca14 APN 7 120216125 splice site probably benign
IGL01524:Abca14 APN 7 120253421 missense possibly damaging 0.57
IGL01747:Abca14 APN 7 120278087 missense probably benign 0.00
IGL02214:Abca14 APN 7 120294175 missense probably benign 0.09
IGL02215:Abca14 APN 7 120253389 missense probably benign 0.00
IGL02253:Abca14 APN 7 120207959 missense probably benign 0.29
IGL02302:Abca14 APN 7 120318745 splice site probably benign
IGL03391:Abca14 APN 7 120246884 missense probably damaging 1.00
F6893:Abca14 UTSW 7 120325038 missense probably damaging 0.98
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0265:Abca14 UTSW 7 120223627 missense probably benign 0.03
R0326:Abca14 UTSW 7 120224419 missense probably damaging 1.00
R0380:Abca14 UTSW 7 120278480 missense probably benign 0.03
R0418:Abca14 UTSW 7 120207434 missense probably damaging 1.00
R0539:Abca14 UTSW 7 120207797 missense probably damaging 1.00
R0574:Abca14 UTSW 7 120224497 missense probably damaging 0.96
R0611:Abca14 UTSW 7 120252256 missense possibly damaging 0.63
R0783:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0785:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0863:Abca14 UTSW 7 120216230 missense probably benign 0.03
R1034:Abca14 UTSW 7 120216147 missense probably damaging 1.00
R1056:Abca14 UTSW 7 120325072 missense probably damaging 1.00
R1072:Abca14 UTSW 7 120212769 missense probably benign
R1244:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1255:Abca14 UTSW 7 120207793 missense probably damaging 0.97
R1271:Abca14 UTSW 7 120325117 missense probably damaging 1.00
R1325:Abca14 UTSW 7 120247322 missense probably benign 0.32
R1457:Abca14 UTSW 7 120289460 missense probably benign 0.00
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1494:Abca14 UTSW 7 120216301 missense probably benign 0.00
R1551:Abca14 UTSW 7 120318878 missense probably benign 0.10
R1607:Abca14 UTSW 7 120251291 missense probably damaging 1.00
R1739:Abca14 UTSW 7 120278306 missense probably benign 0.04
R1856:Abca14 UTSW 7 120278181 missense probably damaging 1.00
R1875:Abca14 UTSW 7 120247967 missense possibly damaging 0.78
R1892:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1898:Abca14 UTSW 7 120251169 missense probably damaging 1.00
R1958:Abca14 UTSW 7 120325159 missense probably damaging 0.98
R2018:Abca14 UTSW 7 120216185 missense probably benign 0.00
R2039:Abca14 UTSW 7 120312264 missense probably damaging 0.98
R2060:Abca14 UTSW 7 120227518 nonsense probably null
R2202:Abca14 UTSW 7 120289541 missense probably benign 0.17
R2205:Abca14 UTSW 7 120247280 missense probably damaging 0.98
R2360:Abca14 UTSW 7 120251208 missense probably benign 0.00
R2401:Abca14 UTSW 7 120283089 missense probably damaging 1.00
R2426:Abca14 UTSW 7 120283223 missense probably benign 0.04
R3433:Abca14 UTSW 7 120294232 missense probably damaging 0.97
R4598:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4599:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4700:Abca14 UTSW 7 120312705 critical splice donor site probably null
R4751:Abca14 UTSW 7 120312177 missense probably benign 0.01
R4826:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4837:Abca14 UTSW 7 120246980 missense probably benign
R4881:Abca14 UTSW 7 120278249 missense possibly damaging 0.49
R4895:Abca14 UTSW 7 120247349 critical splice donor site probably null
R4928:Abca14 UTSW 7 120324580 missense possibly damaging 0.90
R4990:Abca14 UTSW 7 120312165 missense probably benign 0.00
R5027:Abca14 UTSW 7 120312282 missense probably benign 0.05
R5091:Abca14 UTSW 7 120252274 missense probably damaging 1.00
R5158:Abca14 UTSW 7 120253429 missense probably benign
R5209:Abca14 UTSW 7 120232907 missense probably benign 0.01
R5333:Abca14 UTSW 7 120289546 nonsense probably null
R5424:Abca14 UTSW 7 120211554 missense probably benign 0.01
R5488:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5489:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5716:Abca14 UTSW 7 120246994 critical splice donor site probably null
R6450:Abca14 UTSW 7 120216226 missense probably benign 0.17
R6477:Abca14 UTSW 7 120325102 missense probably benign 0.44
R6652:Abca14 UTSW 7 120246941 missense probably damaging 1.00
R6782:Abca14 UTSW 7 120248085 missense probably damaging 1.00
R6874:Abca14 UTSW 7 120252205 missense possibly damaging 0.71
R6965:Abca14 UTSW 7 120283229 nonsense probably null
R7142:Abca14 UTSW 7 120251183 missense possibly damaging 0.89
R7146:Abca14 UTSW 7 120255297 missense probably benign 0.15
R7202:Abca14 UTSW 7 120318013 missense probably damaging 1.00
R7220:Abca14 UTSW 7 120227444 missense possibly damaging 0.45
R7241:Abca14 UTSW 7 120246961 missense probably damaging 1.00
R7291:Abca14 UTSW 7 120289609 nonsense probably null
R7296:Abca14 UTSW 7 120278311 missense probably benign
R7298:Abca14 UTSW 7 120207883 missense probably benign 0.00
R7315:Abca14 UTSW 7 120294118 missense probably benign 0.00
R7776:Abca14 UTSW 7 120232991 critical splice donor site probably null
R7820:Abca14 UTSW 7 120212721 missense probably benign 0.42
R7873:Abca14 UTSW 7 120289569 missense probably benign 0.17
R8215:Abca14 UTSW 7 120294202 missense probably benign
R8332:Abca14 UTSW 7 120216213 missense probably benign
Z1088:Abca14 UTSW 7 120216135 missense probably benign 0.14
Z1176:Abca14 UTSW 7 120246923 missense probably damaging 1.00
Z1177:Abca14 UTSW 7 120317987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCTGAACTTGACAGTCTCTG -3'
(R):5'- ACACACTATTCTGCTGGCCC -3'

Sequencing Primer
(F):5'- CCTGAACTTGACAGTCTCTGGTTTTG -3'
(R):5'- TCTGCTGGCCCAGAATATTAC -3'
Posted On2016-03-01