Incidental Mutation 'R4828:Dip2c'
ID372611
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 042444-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R4828 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9560679 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 356 (W356R)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: W356R

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
AA Change: W412R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: W412R

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: W356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: W356R

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221729
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (106/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Adat3 T C 10: 80,607,047 S240P probably benign Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Alg2 A G 4: 47,471,563 V415A probably benign Het
Alpk2 T C 18: 65,349,113 E141G probably benign Het
Ampd1 A C 3: 103,081,097 T115P probably damaging Het
Ankrd12 A G 17: 65,984,637 L1267P probably damaging Het
Arfgef3 A T 10: 18,652,693 S315R probably damaging Het
Atp10d A C 5: 72,239,118 D222A probably benign Het
B9d1 A G 11: 61,507,635 E47G probably damaging Het
Bag2 T C 1: 33,746,887 D118G probably damaging Het
Bnip3l G T 14: 67,008,759 P9Q probably damaging Het
Casp8ap2 A G 4: 32,639,807 N287S probably benign Het
Ccdc190 A G 1: 169,933,896 D189G probably damaging Het
Ccdc88a A G 11: 29,463,210 K583E probably damaging Het
Cd84 A T 1: 171,872,748 N144I probably damaging Het
Chrnd A G 1: 87,191,571 probably benign Het
Clca3b G T 3: 144,844,512 T224K probably benign Het
Crcp A G 5: 130,059,762 T119A probably damaging Het
Cul2 T C 18: 3,431,013 Y596H probably damaging Het
Dlc1 T A 8: 36,850,246 Q425L possibly damaging Het
Dnah7b T A 1: 46,128,112 V588D possibly damaging Het
Dock4 G T 12: 40,668,437 G245W probably damaging Het
Dpf3 A G 12: 83,294,499 I160T possibly damaging Het
Dstyk A G 1: 132,434,137 T102A probably benign Het
Eif3d A T 15: 77,960,029 L425* probably null Het
Elac2 A G 11: 64,995,327 E477G probably damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Ext2 G A 2: 93,795,767 T316I probably benign Het
Fbf1 A G 11: 116,148,951 V694A probably benign Het
Fgg G A 3: 83,008,370 probably benign Het
Flnb G A 14: 7,919,238 V1664I probably benign Het
Flnc G A 6: 29,455,167 D1932N probably damaging Het
Gm1818 A T 12: 48,555,626 noncoding transcript Het
Gnai1 G A 5: 18,291,472 S151L probably damaging Het
Golph3l G A 3: 95,591,748 R67H possibly damaging Het
Grk5 T A 19: 60,987,775 C42* probably null Het
Herc1 G A 9: 66,497,343 probably null Het
Hey2 A T 10: 30,834,183 H191Q possibly damaging Het
Il11 A G 7: 4,776,482 V8A probably benign Het
Il23r G A 6: 67,431,651 P402L probably benign Het
Irf5 A G 6: 29,531,141 N2S probably damaging Het
Lamb1 T C 12: 31,298,930 Y606H probably benign Het
Larp4b C T 13: 9,170,898 R650C probably damaging Het
Lrpap1 T C 5: 35,102,421 E111G possibly damaging Het
Lrrc36 T A 8: 105,455,230 S388T probably benign Het
Med27 T C 2: 29,377,938 probably benign Het
Mrc1 T G 2: 14,270,206 D439E probably damaging Het
Notch4 A T 17: 34,570,060 E444D probably damaging Het
Nrm G A 17: 35,864,190 V137I possibly damaging Het
Nxpe5 T A 5: 138,230,533 L4Q possibly damaging Het
Obscn A G 11: 59,086,670 V2052A possibly damaging Het
Oc90 A T 15: 65,881,559 Y304N probably damaging Het
Olfr1046 T A 2: 86,217,533 H59L possibly damaging Het
Olfr275 T C 4: 52,826,138 V247A probably damaging Het
Olfr491 T C 7: 108,317,470 V192A probably benign Het
Olfr653 T A 7: 104,579,973 F109Y possibly damaging Het
Olfr888 T C 9: 38,108,740 I13T probably damaging Het
Parp10 A T 15: 76,243,081 I52N probably benign Het
Pdgfrb C A 18: 61,073,243 R608S probably damaging Het
Pecam1 A G 11: 106,699,808 C47R probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pkhd1l1 A G 15: 44,529,405 E1712G possibly damaging Het
Plce1 T C 19: 38,769,499 I1958T probably damaging Het
Plch2 C T 4: 154,984,635 R1073Q probably benign Het
Pld5 A C 1: 176,274,867 I3S probably benign Het
Polr1a T C 6: 71,966,401 W1207R possibly damaging Het
Polr2m T G 9: 71,483,768 I51L possibly damaging Het
Ppl G A 16: 5,104,926 R234C probably damaging Het
Ppp1r42 C T 1: 9,999,411 R142H probably benign Het
Prokr1 A G 6: 87,581,242 V387A probably benign Het
Prss23 A T 7: 89,509,900 Y320* probably null Het
Ptprk A T 10: 28,560,054 M804L probably damaging Het
Rdh16f2 A G 10: 127,874,954 S147G probably benign Het
Rgs7bp T C 13: 105,053,024 H89R possibly damaging Het
Rilpl2 G T 5: 124,469,812 T115K possibly damaging Het
Rnf212 G A 5: 108,729,468 S153F probably damaging Het
Rnf213 A G 11: 119,416,629 D705G possibly damaging Het
Selenbp2 A G 3: 94,704,119 N379S probably benign Het
Sema3e G A 5: 14,226,640 V312M probably damaging Het
Sh2d5 T A 4: 138,258,255 L338Q probably damaging Het
Shank3 A G 15: 89,500,199 probably benign Het
Skor2 G T 18: 76,860,418 G612C probably damaging Het
Slc22a16 A G 10: 40,573,640 Y24C probably damaging Het
Slc4a1ap T A 5: 31,530,709 Y312* probably null Het
Slc5a7 A T 17: 54,276,799 F488I probably benign Het
Snrnp200 A G 2: 127,211,607 D130G probably damaging Het
Sorbs2 T A 8: 45,741,615 probably benign Het
Tmem91 T G 7: 25,669,378 T161P probably damaging Het
Tpd52l1 G A 10: 31,346,701 T99M probably damaging Het
Trps1 A G 15: 50,660,677 *1036Q probably null Het
Tshr A T 12: 91,537,790 T501S probably damaging Het
Tubgcp3 T C 8: 12,671,987 N15S probably benign Het
Unc5b A G 10: 60,772,348 S669P possibly damaging Het
Zfp970 A G 2: 177,475,353 E240G probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTACTTCCGAGTGCAAG -3'
(R):5'- CAACCTTACTCTACCAAGGAGG -3'

Sequencing Primer
(F):5'- ACTTCCGAGTGCAAGTTCAG -3'
(R):5'- CCAAGGAGGAAGAACAGACTGAGTTC -3'
Posted On2016-03-01