Incidental Mutation 'R4830:Inpp4a'
ID 372717
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Name inositol polyphosphate-4-phosphatase, type I
Synonyms 107kDa
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R4830 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 37338946-37449817 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37410861 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 343 (M343K)
Ref Sequence ENSEMBL: ENSMUSP00000115249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000168546] [ENSMUST00000140264] [ENSMUST00000137266] [ENSMUST00000193774]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027287
AA Change: M343K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058307
AA Change: M78K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: M78K

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114933
AA Change: M78K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: M78K

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132401
AA Change: M343K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132615
AA Change: M343K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136846
AA Change: M343K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168546
AA Change: M78K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: M78K

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140264
AA Change: M343K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137266
AA Change: M343K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: M343K

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193774
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Meta Mutation Damage Score 0.3025 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Agbl5 G A 5: 31,048,059 (GRCm39) R111H probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nedd1 T A 10: 92,522,120 (GRCm39) N639I probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Opn5 T C 17: 42,922,187 (GRCm39) H5R probably benign Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Rgl1 T C 1: 152,430,081 (GRCm39) D234G probably benign Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Smtn A G 11: 3,470,736 (GRCm39) probably benign Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37,427,986 (GRCm39) missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37,416,798 (GRCm39) missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37,428,793 (GRCm39) missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37,416,650 (GRCm39) intron probably benign
IGL02040:Inpp4a APN 1 37,435,166 (GRCm39) missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37,405,708 (GRCm39) intron probably benign
IGL02318:Inpp4a APN 1 37,407,384 (GRCm39) missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37,419,049 (GRCm39) missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37,418,115 (GRCm39) missense probably benign 0.26
stultified UTSW 1 37,426,911 (GRCm39) missense probably damaging 0.99
R0265:Inpp4a UTSW 1 37,418,067 (GRCm39) missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37,435,241 (GRCm39) missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37,408,573 (GRCm39) intron probably benign
R1269:Inpp4a UTSW 1 37,428,823 (GRCm39) missense probably benign 0.01
R1719:Inpp4a UTSW 1 37,437,880 (GRCm39) missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37,432,059 (GRCm39) missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37,406,000 (GRCm39) missense probably benign 0.08
R2143:Inpp4a UTSW 1 37,426,827 (GRCm39) missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37,435,211 (GRCm39) missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37,416,777 (GRCm39) missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37,405,247 (GRCm39) missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37,432,037 (GRCm39) missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37,405,675 (GRCm39) missense probably benign 0.07
R2898:Inpp4a UTSW 1 37,405,675 (GRCm39) missense probably benign 0.07
R4934:Inpp4a UTSW 1 37,426,922 (GRCm39) missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37,419,168 (GRCm39) missense probably benign 0.17
R5152:Inpp4a UTSW 1 37,397,616 (GRCm39) missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37,406,854 (GRCm39) missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37,411,410 (GRCm39) missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37,411,451 (GRCm39) missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37,416,829 (GRCm39) missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37,419,183 (GRCm39) missense probably benign
R6434:Inpp4a UTSW 1 37,437,919 (GRCm39) missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37,426,839 (GRCm39) missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37,411,422 (GRCm39) missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37,428,772 (GRCm39) missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37,408,504 (GRCm39) missense probably benign 0.00
R7126:Inpp4a UTSW 1 37,413,353 (GRCm39) missense probably benign 0.00
R7473:Inpp4a UTSW 1 37,408,534 (GRCm39) missense probably benign 0.37
R7509:Inpp4a UTSW 1 37,426,911 (GRCm39) missense probably damaging 0.99
R7654:Inpp4a UTSW 1 37,413,179 (GRCm39) splice site probably null
R7920:Inpp4a UTSW 1 37,406,886 (GRCm39) missense probably benign 0.08
R8273:Inpp4a UTSW 1 37,407,520 (GRCm39) intron probably benign
R8739:Inpp4a UTSW 1 37,422,207 (GRCm39) intron probably benign
R9158:Inpp4a UTSW 1 37,442,552 (GRCm39) missense possibly damaging 0.76
R9281:Inpp4a UTSW 1 37,410,850 (GRCm39) missense probably damaging 1.00
R9678:Inpp4a UTSW 1 37,405,952 (GRCm39) missense probably damaging 0.97
RF006:Inpp4a UTSW 1 37,427,908 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGTTGAGACAGGCCTGCTTC -3'
(R):5'- AATGACCGGCAACTTTCTGC -3'

Sequencing Primer
(F):5'- ACAGGCCTGCTTCCGTGTAG -3'
(R):5'- CTGAAAAATTTCAAAGGTCCTTGGG -3'
Posted On 2016-03-01