Incidental Mutation 'R4830:Rgl1'
ID372719
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152554330 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000027760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859] [ENSMUST00000149536]
PDB Structure
SOLUTION STRUCTURE OF THE RAS-BINDING DOMAIN OF RGL [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027760
AA Change: D234G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: D234G

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111857
AA Change: D232G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: D232G

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111859
AA Change: D269G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: D269G

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128251
Predicted Effect probably benign
Transcript: ENSMUST00000149536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188395
Meta Mutation Damage Score 0.1700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152552620 missense probably damaging 1.00
R7774:Rgl1 UTSW 1 152554350 missense probably benign
RF005:Rgl1 UTSW 1 152521363 missense probably benign
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATGCACTTTCACCCAGGGC -3'
(R):5'- GCCCTTTTCTTCCTGAATGAAAG -3'

Sequencing Primer
(F):5'- GCCGAGGCTTAAATTATTCACACG -3'
(R):5'- CCTTTTCTTCCTGAATGAAAGAAGTG -3'
Posted On2016-03-01