Incidental Mutation 'R4830:Rgl1'
ID 372719
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Name ral guanine nucleotide dissociation stimulator,-like 1
Synonyms Rgl
MMRRC Submission 042446-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R4830 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 152392513-152642089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152430081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000027760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859] [ENSMUST00000149536]
AlphaFold Q60695
PDB Structure SOLUTION STRUCTURE OF THE RAS-BINDING DOMAIN OF RGL [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027760
AA Change: D234G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: D234G

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111857
AA Change: D232G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: D232G

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111859
AA Change: D269G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: D269G

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128251
Predicted Effect probably benign
Transcript: ENSMUST00000149536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188395
Meta Mutation Damage Score 0.1700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,553,933 (GRCm39) G643V probably damaging Het
Adamtsl1 A G 4: 86,274,619 (GRCm39) E1225G probably damaging Het
Agbl5 G A 5: 31,048,059 (GRCm39) R111H probably damaging Het
Ankle2 A C 5: 110,389,879 (GRCm39) K446Q probably damaging Het
Boc A C 16: 44,310,520 (GRCm39) M800R probably damaging Het
Ccnt1 A T 15: 98,441,332 (GRCm39) N645K probably damaging Het
Cd93 G A 2: 148,285,299 (GRCm39) Q16* probably null Het
Cpsf4l G T 11: 113,600,328 (GRCm39) probably benign Het
Cuzd1 T A 7: 130,919,783 (GRCm39) D111V probably damaging Het
Dab2 T C 15: 6,457,008 (GRCm39) C232R probably benign Het
Dmpk A T 7: 18,821,453 (GRCm39) Y237F probably damaging Het
Dnah6 T A 6: 73,021,745 (GRCm39) T3526S possibly damaging Het
Dock2 T C 11: 34,223,767 (GRCm39) probably null Het
Dsp G A 13: 38,376,840 (GRCm39) V1542I probably benign Het
Dst T A 1: 34,237,586 (GRCm39) probably null Het
Esd T C 14: 74,978,600 (GRCm39) L54S probably damaging Het
Exd1 C T 2: 119,350,807 (GRCm39) A485T probably benign Het
Gm3604 A T 13: 62,516,857 (GRCm39) N500K probably damaging Het
Grhl2 T A 15: 37,335,903 (GRCm39) probably null Het
Gsto1 C T 19: 47,852,830 (GRCm39) R222C probably benign Het
Inpp4a T A 1: 37,410,861 (GRCm39) M343K probably damaging Het
Itpripl2 T C 7: 118,090,280 (GRCm39) Q93R probably benign Het
Jakmip2 G A 18: 43,700,208 (GRCm39) T450I probably benign Het
Kdm6b A T 11: 69,294,620 (GRCm39) I1186N unknown Het
Kif1a T C 1: 92,948,931 (GRCm39) probably null Het
Klhl20 T C 1: 160,925,946 (GRCm39) K434R probably benign Het
Lemd3 T C 10: 120,767,853 (GRCm39) D697G probably damaging Het
Lipo3 A G 19: 33,753,987 (GRCm39) S383P probably damaging Het
Ltn1 C A 16: 87,176,582 (GRCm39) K1741N probably damaging Het
Lvrn A T 18: 47,038,418 (GRCm39) T991S probably damaging Het
Macroh2a2 C T 10: 61,575,132 (GRCm39) D355N possibly damaging Het
Mast3 C A 8: 71,241,559 (GRCm39) R151L possibly damaging Het
Mplkipl1 C T 19: 61,164,364 (GRCm39) G24R unknown Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myoz1 T C 14: 20,705,377 (GRCm39) K14E probably damaging Het
Neb G T 2: 52,082,532 (GRCm39) Q5450K probably damaging Het
Nedd1 T A 10: 92,522,120 (GRCm39) N639I probably damaging Het
Nlrp4e A T 7: 23,036,165 (GRCm39) N673Y probably benign Het
Nop53 C T 7: 15,676,129 (GRCm39) R190Q probably damaging Het
Notch4 T C 17: 34,789,092 (GRCm39) Y468H probably damaging Het
Obscn T C 11: 58,958,433 (GRCm39) T3507A probably damaging Het
Opn5 T C 17: 42,922,187 (GRCm39) H5R probably benign Het
Or4l15 T C 14: 50,197,681 (GRCm39) N283D probably damaging Het
Patl1 T C 19: 11,902,515 (GRCm39) M349T probably benign Het
Phactr3 A G 2: 177,925,811 (GRCm39) N362S probably damaging Het
Pirb C T 7: 3,720,602 (GRCm39) G299S probably benign Het
Rapgef5 G A 12: 117,719,809 (GRCm39) R579Q probably damaging Het
Serpinb3a C T 1: 106,976,316 (GRCm39) E122K probably benign Het
Slc22a15 T C 3: 101,782,919 (GRCm39) probably benign Het
Slc25a12 A T 2: 71,127,149 (GRCm39) V344E probably damaging Het
Slc43a2 T C 11: 75,434,119 (GRCm39) L99P probably damaging Het
Smim27 G T 4: 40,269,719 (GRCm39) probably null Het
Smtn A G 11: 3,470,736 (GRCm39) probably benign Het
Szt2 A T 4: 118,226,445 (GRCm39) Y3001N unknown Het
Tgfbr3 G T 5: 107,257,585 (GRCm39) P825T probably damaging Het
Tnpo3 T C 6: 29,568,937 (GRCm39) T472A probably benign Het
Trf T A 9: 103,105,114 (GRCm39) D66V probably damaging Het
Vmn1r124 A G 7: 20,993,624 (GRCm39) C307R probably damaging Het
Vps13b T A 15: 35,452,370 (GRCm39) F656Y possibly damaging Het
Zic1 G T 9: 91,244,584 (GRCm39) S358R probably damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152,447,368 (GRCm39) missense probably benign 0.02
IGL01065:Rgl1 APN 1 152,394,893 (GRCm39) missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152,447,339 (GRCm39) splice site probably benign
IGL01726:Rgl1 APN 1 152,394,904 (GRCm39) missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152,424,901 (GRCm39) missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152,404,220 (GRCm39) splice site probably benign
IGL02369:Rgl1 APN 1 152,409,357 (GRCm39) missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152,430,175 (GRCm39) unclassified probably benign
R0255:Rgl1 UTSW 1 152,428,347 (GRCm39) missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152,415,696 (GRCm39) missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152,412,016 (GRCm39) critical splice donor site probably null
R0734:Rgl1 UTSW 1 152,430,051 (GRCm39) missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152,420,184 (GRCm39) missense probably benign 0.14
R1522:Rgl1 UTSW 1 152,462,284 (GRCm39) missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152,550,774 (GRCm39) splice site probably benign
R1634:Rgl1 UTSW 1 152,400,523 (GRCm39) missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152,409,326 (GRCm39) missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152,409,326 (GRCm39) missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152,424,855 (GRCm39) missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152,412,032 (GRCm39) missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152,412,040 (GRCm39) missense probably benign 0.13
R4668:Rgl1 UTSW 1 152,397,122 (GRCm39) missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152,397,122 (GRCm39) missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152,400,450 (GRCm39) nonsense probably null
R4853:Rgl1 UTSW 1 152,433,325 (GRCm39) missense probably benign 0.07
R4969:Rgl1 UTSW 1 152,424,813 (GRCm39) splice site probably null
R5778:Rgl1 UTSW 1 152,428,172 (GRCm39) missense probably benign 0.05
R5979:Rgl1 UTSW 1 152,433,244 (GRCm39) missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152,394,923 (GRCm39) missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152,462,321 (GRCm39) missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152,428,186 (GRCm39) missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152,400,475 (GRCm39) missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152,409,281 (GRCm39) missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152,415,691 (GRCm39) missense probably benign 0.00
R7290:Rgl1 UTSW 1 152,420,146 (GRCm39) missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152,394,914 (GRCm39) missense probably damaging 1.00
R7610:Rgl1 UTSW 1 152,428,371 (GRCm39) missense probably damaging 1.00
R7774:Rgl1 UTSW 1 152,430,101 (GRCm39) missense probably benign
R8140:Rgl1 UTSW 1 152,433,252 (GRCm39) missense probably damaging 1.00
R9188:Rgl1 UTSW 1 152,394,922 (GRCm39) missense probably damaging 1.00
R9190:Rgl1 UTSW 1 152,428,362 (GRCm39) missense probably damaging 0.96
R9297:Rgl1 UTSW 1 152,400,454 (GRCm39) missense possibly damaging 0.89
R9318:Rgl1 UTSW 1 152,400,454 (GRCm39) missense possibly damaging 0.89
R9491:Rgl1 UTSW 1 152,424,869 (GRCm39) missense probably damaging 1.00
R9570:Rgl1 UTSW 1 152,430,082 (GRCm39) missense possibly damaging 0.47
R9610:Rgl1 UTSW 1 152,397,115 (GRCm39) missense probably benign 0.13
R9640:Rgl1 UTSW 1 152,397,142 (GRCm39) missense probably damaging 1.00
RF005:Rgl1 UTSW 1 152,397,114 (GRCm39) missense probably benign
Z1088:Rgl1 UTSW 1 152,550,771 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AATGCACTTTCACCCAGGGC -3'
(R):5'- GCCCTTTTCTTCCTGAATGAAAG -3'

Sequencing Primer
(F):5'- GCCGAGGCTTAAATTATTCACACG -3'
(R):5'- CCTTTTCTTCCTGAATGAAAGAAGTG -3'
Posted On 2016-03-01