Incidental Mutation 'R4830:Klhl20'
ID372720
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Namekelch-like 20
SynonymsD930050H05Rik
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161088375-161131511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 161098376 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 434 (K434R)
Ref Sequence ENSEMBL: ENSMUSP00000114044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]
Predicted Effect probably benign
Transcript: ENSMUST00000111611
AA Change: K434R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: K434R

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117467
AA Change: K434R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: K434R

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192890
Predicted Effect probably benign
Transcript: ENSMUST00000195584
SMART Domains Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705

DomainStartEndE-ValueType
Kelch 1 40 1.43e-4 SMART
Kelch 41 87 1.59e-11 SMART
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 161109755 missense probably benign 0.00
IGL00903:Klhl20 APN 1 161090506 missense probably benign 0.00
IGL01574:Klhl20 APN 1 161093726 missense probably damaging 1.00
IGL01721:Klhl20 APN 1 161095587 missense probably damaging 1.00
IGL01933:Klhl20 APN 1 161106787 missense probably damaging 1.00
IGL02187:Klhl20 APN 1 161109710 missense probably benign 0.05
IGL02634:Klhl20 APN 1 161098365 missense probably damaging 0.98
IGL02691:Klhl20 APN 1 161106874 splice site probably benign
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0102:Klhl20 UTSW 1 161090445 nonsense probably null
R0639:Klhl20 UTSW 1 161093711 missense probably damaging 1.00
R1730:Klhl20 UTSW 1 161102990 missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 161106742 missense probably benign 0.00
R2016:Klhl20 UTSW 1 161103038 missense probably damaging 0.98
R2901:Klhl20 UTSW 1 161109552 nonsense probably null
R4822:Klhl20 UTSW 1 161093763 nonsense probably null
R4894:Klhl20 UTSW 1 161109532 missense possibly damaging 0.76
R4981:Klhl20 UTSW 1 161103005 missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 161101586 missense probably damaging 0.98
R5023:Klhl20 UTSW 1 161109220 critical splice donor site probably null
R5108:Klhl20 UTSW 1 161099250 missense probably damaging 0.99
R5216:Klhl20 UTSW 1 161093679 critical splice donor site probably null
R5659:Klhl20 UTSW 1 161090470 missense probably damaging 1.00
R6159:Klhl20 UTSW 1 161105467 missense probably damaging 1.00
R6836:Klhl20 UTSW 1 161105406 missense probably benign 0.18
R6914:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6915:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 161093696 missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 161109257 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCAGGAAAATGTGTTGC -3'
(R):5'- CACCGCAATGTACTTTAGATTTCC -3'

Sequencing Primer
(F):5'- GCATTTGGAACTCATACTGCTG -3'
(R):5'- CACTGAGAGTGGAATCCTCTACTG -3'
Posted On2016-03-01