Incidental Mutation 'R4830:Slc25a12'
ID372722
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71296805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 344 (V344E)
Ref Sequence ENSEMBL: ENSMUSP00000122103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147553
Predicted Effect probably damaging
Transcript: ENSMUST00000151937
AA Change: V344E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: V344E

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184169
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Meta Mutation Damage Score 0.9437 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myoz1 T C 14: 20,655,309 K14E probably damaging Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1832:Slc25a12 UTSW 2 71333710 missense possibly damaging 0.85
R2044:Slc25a12 UTSW 2 71312548 missense probably benign 0.00
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R6516:Slc25a12 UTSW 2 71324083 missense probably damaging 0.97
R7270:Slc25a12 UTSW 2 71324025 missense probably benign
R7794:Slc25a12 UTSW 2 71311508 missense probably damaging 1.00
R8022:Slc25a12 UTSW 2 71275189 missense unknown
Z1176:Slc25a12 UTSW 2 71296746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATCACCAACGTCGGCGG -3'
(R):5'- TTGTCCCTTAAGCAGACCCG -3'

Sequencing Primer
(F):5'- GCTGAGCTGCGCGTACTC -3'
(R):5'- CTTAAGCAGACCCGGTTGCTTG -3'
Posted On2016-03-01